| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAGGGAUGGUUUAACAAAAUGAAGGCACUCAUUGCAGCACUGCUUUUGA… | 1947 nt | 0.4679 |
This histidine-rich glycoprotein contains two cystatin-like domains and is located in plasma and platelets. The physiological function has not been determined but it is known that the protein binds heme, dyes and divalent metal ions. The encoded protein also has a peptide that displays antimicrobial activity against C. albicans, E. coli, S. aureus, P. aeruginosa, and E. faecalis. It can inhibit rosette formation and interacts with heparin, thrombospondin and plasminogen. Two of the protein's effects, the inhibition of fibrinolysis and the reduction of inhibition of coagulation, indicate a potential prothrombotic effect. Mutations in this gene lead to thrombophilia due to abnormal histidine-rich glycoprotein levels. [provided by RefSeq, Nov 2014]
A study in humans demonstrated that combining gene expression profiles from multiple tissues, specifically the pituitary and skeletal muscle, improved chronological age prediction accuracy to a root-mean-square error of 3.6 years [Wang et al. DOI:10.3389/fgene.2020.01025].