Basic Information

Symbol
HRG
RNA class
mRNA
Alias
Histidine Rich Glycoprotein HPRG Histidine-Rich Glycoprotein HRGP Histidine-Proline-Rich Glycoprotein Histidine-Proline Rich Glycoprotein Thrombophilia Due To Elevated HRG THPH11
Location (GRCh38)
Forensic tag(s)
Chronological age estimation

MANE select

Transcript ID
NM_000412.5
Sequence length
1947.0 nt
GC content
0.4679

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-504.60 kcal/mol
Thermodynamic ensemble
Free energy: -542.75 kcal/mol
Frequency: 0.0000
Diversity: 563.53
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((..((((((((((.(((((......)))))((((((((((.......(((...(((.........))).)))((((.....))))))))))))))(((..((((((((((...((....((..(((((........(((...((((((..((((((((((((((......)))))....(((.((((.((((.((((((...((((....)))).)))))).)))).)).)).))).....((((((((((((((...(((((......)))))..)))))((.((((.((((....(((((((((((.........))).))))(((((...(((.....)))...))))).((.(((...))))).....(((((.....)))))((((........))))..))))..))))...))))))........)))))))))(((((((.((....)).))))))).(((((.(((...................))).))).))........(((((((..(((((((((.(((((((((.((..........)))))))))..((((.((((.((((((((...((((.(((....((((((.....((.((((.(((...(((((((((((((((............((((.((((..((.((((((((((((....))))).....))))))).))..)))))))).................(((....(((....)))....))).((((......))))......))))))))............(((....))).....)))))))((((.((((.(..(((........)))....).)))).))))....((((....)))).......))).))))))...))))))...(((........)))((((..(((..(....)..)))..))))...))).))))......)))))))))))).)))).........))..)))))))))...(((((....)))))...((((((........((((.................))))........))))))....(((((...(((((..........((.((.........)).))..........)))))...))))).....((.((((.((((((((((.........)))))).........((((((.((......((((((.........)))))).............))))))))..((((......))))....((((((.................))))))((((((.((((..((((.((...((((((((.(((........)))))))))))...))...)))).....)))).))).)))....)))))))).))........)))))))..))))))))).(((((.((........(((((...........))))).....)).))))).....)))))).....))).....)))))..))...))...))))))))))..))).(((((((((((....(((((((....))))........((((((((......(((((((........))))))).((((((....))))))((((.......)))).....))))))))........(((..((.((((((((...))))))))))..))).((((..(((((((((......))).....))))))))))....(((.((((...(((.......(((((((....((.(((((.((((......(((((......)))))...)))).)).))).))....)))...))))......)))..)))))))....)))....)))))))))))...((((((....)))))).........)).))))))))..))).(.((((((.....)))))).)..........
Thermodynamic Ensemble Prediction
..((((((((.............(({.,(((..((((((((((.......,{{.,.(({,,......,))).)))|{|{.....))},))))))))))))))))(((,(((({(,...,}}|,|.{{{..........,}||,..(((((((...,{.........{((((.(({,,({((,((({(((({,,,,.||||||...{{((...,||||,||}||,.}}}}.})|)),))}.,.,{((((((((({((((...(((((......))))),.}|||,{{|(|,..{{({|||.,{,,(((((((,,.....,.))),||||,(({(..,(((...,,}}}...}}}}|,{,.{||...}))))..,,,|{|||....,||},,{(((........)))},,}}},..})))..,)))},,.,,}}...,))})))))|((((({.{(....|}.}))))}}.,{{,{.({{..........,}}.......},,}}|}}},,},...,,||((.((({{{{{.{||,.}||||||{.{{.|,,,,....}}}}}})}}..((((.((((.((((((((...((((.(((....(((((((,,,,{{,(({(.(({.,{(,,,|||((((((({,,...,|,....((((.((((..((.{(((((({{({(,,..}}}))}....})))))}.))..))))))))......{{{,.....,..((({,...}}})),}},},,),,.((((......))))......}))))))).,,||,,{,,,{(((....|||.,||,.|)))||((({,((({.{.,,,,,,,.....,.||,,...,.,..))}}.,}}||,,.,}})},}....},.)}).)))}}}.,.},}}},..,((,...,,...,,,{|||,,|||..|,,,.,..)),,,))))...))).))))......)))))))))))).))))...||},,.||}},,}|,}},....{((((....)))))...((((((......{.{{{{....,............})))........)))))).,))))))}}},,.,...))))),,}....))...))))))),{||,.........,||}}...}}},......,.,.)))).}}}((((((.........))))))...,,,({{..,,)),........((((((.........))))))..))))))))((.(((((((...{{,..,.((((((.....((((((.................)))))).....))))))..,{((.((...((((((((.(((........)))))))))))...))...}}))|{.{{(({{{{(({{{.....,},}}}}}((({(..{{((((..({...))..))).)}))))}.,,,.{{{|{(.((((((.((((((((..{((.((((((.(((.,..........{{{......}}}......,{,({,,,,,...{{{{...|||}.....,..,))))}||{...{((((((((,.......{{{{,.{((({{{,..,,,,{((((((........))))))).((((((....)))))){{{{.......}}}}.....,)))))}}........,((..((.((((((({...))))))))))..)))))))))))}...,,)},.}.))).))),.,)).)))))))))))....)))))).))}}}.|,,,,,.}}}|}}},||,{((((,((((...,.{(((({.....,)))}}...||}|,|}.}}|.............,||||.|,......,}...}}))).,,,,.,))))))))}}||,...((((((....)))))).,.{|||,.((((((((.....))))))))...},,,,.}}))))))).))......

Transcripts

ID Sequence Length GC content
AAGGGAUGGUUUAACAAAAUGAAGGCACUCAUUGCAGCACUGCUUUUGA… 1947 nt 0.4679
Summary

This histidine-rich glycoprotein contains two cystatin-like domains and is located in plasma and platelets. The physiological function has not been determined but it is known that the protein binds heme, dyes and divalent metal ions. The encoded protein also has a peptide that displays antimicrobial activity against C. albicans, E. coli, S. aureus, P. aeruginosa, and E. faecalis. It can inhibit rosette formation and interacts with heparin, thrombospondin and plasminogen. Two of the protein's effects, the inhibition of fibrinolysis and the reduction of inhibition of coagulation, indicate a potential prothrombotic effect. Mutations in this gene lead to thrombophilia due to abnormal histidine-rich glycoprotein levels. [provided by RefSeq, Nov 2014]

Forensic Context

A study in humans demonstrated that combining gene expression profiles from multiple tissues, specifically the pituitary and skeletal muscle, improved chronological age prediction accuracy to a root-mean-square error of 3.6 years [Wang et al. DOI:10.3389/fgene.2020.01025].