Basic Information

Symbol
HRK
RNA class
mRNA
Alias
Harakiri, BCL2 Interacting Protein DP5 BH3-Interacting Domain-Containing Protein 3 Activator Of Apoptosis Harakiri Neuronal Death Protein DP5 Death Protein 5 Harakiri, BCL2-Interacting Protein (Contains Only BH3 Domain) Harakiri, BCL2 Interacting Protein (Contains Only BH3 Domain) Activator Of Apoptosis Hrk HARAKIRI BID3
Location (GRCh38)
Forensic tag(s)
Wound age identification Postmortem interval inference Mechanical injury analysis

MANE select

Transcript ID
NM_003806.4
Sequence length
5789.0 nt
GC content
0.4961

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2037.10 kcal/mol
Thermodynamic ensemble
Free energy: -2143.98 kcal/mol
Frequency: 0.0000
Diversity: 1394.79
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((((......))))((.(((((((((((..(((.((((..(((((((((((((.((((((.((((((((((((((((((((((.((((((((((..(((((((.(((((..(((((..((((..(((.((((((((((....((((..(((..(((((((....)))))))..))).))))))))))).))).))).))))..)))))))))).))).))))...)))))))(((((...((.....))...)))))...(((((((.((((.(((((((....((((((.((((((((.(((((((...))))))).))))...((....))....)))).))))))))))).)).))))..)))))))(((((((..((((((...(((((..((((.......((..((((((.....))))))...))))))..)).)))....)))))).)))))))........((((((((((.(((((((((((((((((.(((....))).)))))))...)))))....(((((.(((((((((((.(((((((((((((((((.((((((((...((((.(((((((((((((.(((((((((((((((((.(((....(((....))))))(((.(.(((.((((....(((((((.((((((((....((((((((((..........(((((.......)))))((.(((.((.((.((((((.((.((((...((((((((((((((((..((((.((.......((((((....))))))((((((((((((.((.(.(((((((((((.(((((.....((((((.((........)).))).)))((((((((((..(((......))).....)))))))).))......)))))))))).....)))))).............(((((.((((((((.......(((((((((.((.((((((((..((........))..))))))))...)).)))))))))...))))))))..)))))((((((((.(.((.......)).)..))))))))...).))))))))))))))......)).)))).))))).....((((((.(((.((((..((((...........((((...(((((..(((((((((((((((.((....)).)))))(((...)))..((((((............))))))(((((.(((....))).)))))((((......))))........((((((..((((.(((.((((.((((((...))))))..(((((...((.(((((.((((((....(((...(((.....(((((((((....))).)))))))))...)))...))))))))))))))))))(((....))).)))))))))))..))).)))..((((....((((....))))....))))....(((..(((((((((...(((((.....)))))....(((......)))))))))))))))((((((.((.(((((((((((.((((.((((.....)))))).((((((((.(((((......(((((((.(((((...(((......)))..((((.....(((((((....))).)))))))).......((((.(((((((..((.((((((((((..(((.((((((((((((((((((((....(((((((((.((((((.......(((.(((((((..((((((((...((.((((...........))))))..((((((((((.(((((.(.((.(((.....((((((((((..((.......))....))))))))))((((.(((....)))))))..((((((((((((((((...((((((.((((.((.((((...((((((((..(((..((((.(.((((((.......)))))).).))))....((((....))))...((((......))))(((((.....((((((..((((.(.((((((.((....)).)))))).).))))....((((....))))......))))))))))).........)))..))))))))............)))).)))))).))))))..))))))...))))))))))...............(((((((.((.(((.....(((((((....................)))))))..))).)))))))))))).)))))))).))..))))))))........................)))))))).))))))).)))((((((.....))))))......(((.(((..(((((..((((((.....(((((....))).)))))))))))))..))))))(((.(((((.......)))))...))).))))...)).)))))))))(((((.........)))))....)))))))))))............(((((((((...((((....)))).....((((((((((.....))))).)))))..............((((((........))))))(.((((.((((.((((.....)))).))))..)))).)(((((..........(((((....)))))....((.((((((.((.....)))))))))).))))).....(((....)))....((((((.(((((((((........)))))......))))..))))))...(((....(((....)))....))).....)))))))))..((((...))))......))))).)))))))..))))))))))))..........((((.((......))))))))).)))).)))))))))..)))))))...(((((.(((.....))).)))))......(((.((((((..........)))))).))).((((..(((((......)))))..)))).(((((((((........)))))))))......(((..(((((....)))))..)))((((((.((((((((.((......))..)))......))))).))))))(((....((((((....))))))...)))))))).)....)))))))......)))))))))....)))).))))))))....)))))))))).)))))..))))...........))))..)))))))))))))((.(......).))....)))))))))))((((((((...............)))).))))..)))).)))))))))).))))).))))))))))))..)))))))).))).))))..)))).))).).)))((((((...(((((((((((((((((((((..(((.....))).((..((.((((...(((((((((((........))))))))))).....)))).))..))))))))))...((((..((((...((....)).))))..))))((((..........))))...(((((((((......)))))....))))(((((((..(((.........................)))....)))))))....(((((((((.....(((((....)))))..))))))))))))))))).(((.(((....)))))).....)))))....))))))(((((.(((....))).))))).)))))).))))))))))).))))...(((((......))))))))).))).......))))))...))))))))....................(((((((...((.......))...)))))))....)))))))))))..)))))).................((((((((...)))))))).(((.(((((((((((.((((.((((.(((((((((((((..((((((((((((((((.((((...((((.(((.(((((....)))))(((((((...........(((.(((..((.((.((((((((((((.((((((((.(((((((((.............(((((((((........))).))))))....(((((((....(((((((....)).))).))..)))))))((((.(((((......)))))))))...(((((((((((((..(......)..)))).)))))))))...(((((...))))).....((.(((((((...((((((((((.(((((.....(((((((.((((..((........))..))))............((.(((((((...))))))).))........(((((((.(((((((((.......(((......(((....))).......)))(((((((....)))))))))))))))).)))))))................))))))))))))..))))).)))))...))))))).))...)))))))))...)))))))))))))))))))).)).)).)))))).)))))))((((((.(((((..((((((((((((.......))))))))).))).))))).(((....)))))))))..(((((((..((((((...))))))..)))))))..((((.(((................))).))))..((((((((......)))))))).........))).)))).))))))))).))).)))))))).)))))...((((((((.(((((..((.((((......))))))))))).))).))).)).((((((.(((((((((((((....))))))...........)))))))))))))..((((....)))).))))..(((((((((.(((((((((.........))))..................((((((..((((.(((.......(((((...........))))).........(((((....))))).....(((((((......))))))).))).))))........((...)).))))))...))))).)))))))))...(((((.((((((((....))))).))).)))))(((((((.........(((.(((.((((..((.....))..)))).)))))))))))))......(((((....))))).(((((((.......((.((((.....)))))).......)))))))....)))).)))).)))).))))).))))))...))).)))))))))).).)))))((((..((((((((((((((..((((.....))))....((((((.((....))))))))......))))))..))))))))...))))......(((((....((((((..(((...(((((((..(((...)))..))))))))))(((((.....)))))..))))))..))))).....))))).))))))))))........))).))))))))...))))))(((((((((....((((((.((((((((....)))))(((((((.((...)).).))))))((((.(((.....))).))))))))))))))))...))))))..........)))))))))))).))...((((.((((((.(.(.(((((.(........).))))).).))))))).))))...))))))))))))).))))..).))..))))...))))))).))......((((....))))..................)).)))))).......
Thermodynamic Ensemble Prediction
((((((({((((......))))({,(((((((({{{{||||,|{{||,(((((((((((((.((((((.((((((((((((((((((((((.((((((((((,,(((((((,((((({.(((,((((,,{|}||,,||{|||{{{|.,,.{(((,,(((|{(({(({{.},})))))))}}))}.})}}))))))),))),}))}))))}|)))}|))))),)||,||||..,|||}}}|{{({{..,|{,,..,))}..)))))}|.(((((((.((((.(((((({,{(((((((,.((((((((.(((((((...))))))).)))),,,{{....))....)))))))))))))))).)).))))..))))))),}{{((({(({(((({{,,|{((..((.,{{{{{,,{{,,{|||||}}}..})||))}..))))}}..,|||}}}}.||||||..||||||,,,...,}}|(((((((((.(((({((((((((((((.(((....))).)))))))...)))))...{(((((,(((,(((((((((((((((((((((((((..{{({{((,(({.((,(,((((,,(((((.(((((((((((((((((.,((....(((....))))}}{{{.,.(((.((((.,,.((((,((.((((((((.{..((((((((((..........{((((.......))))}((.(((.((.{{(((((({{((.((((..(((((((((((((((((..((((.,{.......((((({....})))))((((((((((({.{{.,.(((((({{{{({(((({.....{{{{{{.{,....,,{,|}.,,}}}}}((((((((((..(({......})).....)))))))).))......})}},}))))}},..))))))..,..........(((((.((((((((.......(((((((((.((.((((((((..((........))..)))))))).}},},)))))))))...))))))))..))))),(((((((.{.((.......)).}..)))))))),,.).))))))))))))))......,,.)))).))))).....{((((,{(((.((((..((((,.,...((.,.((((...(((((..((((((((((.{(((((((,,{{{......,,{...})),.{{{{{|............)))))}(((((.(((....))).)))))||||}}}},,}}}}........((((((..((({.(((.((((.((((((...))))))..(((((...((.(((({{((((((....(((.,.(((.....(((((((((....))).))))))))).,.)))...))))))))))))))))))(((....))).)))))))})))..))).))),.{(((....((((....))))....)))}....(((,.{((((((((..,(((((.....))))).,..{{{......))}))))))))))))((((((.((.(((((((((((.(((,(((((.....}))))}.((((((({.(((((......{((((((.((((({{{{,{{{....{{{..((((.({......}).}))}))).,..)))..}}},,..((((.(((((((,.((.((((((((((..(((.((((((((((((((((((((.,..(((((((((.({((((......,(((.(((((((..((((((((...(({(,,(....,..}}},,|||,,..((((((((((.(((((.(.((.(((.,.{(((((((((((.,((.......))....))))))))))}|{|.(((....)))}}}...((((((((((((((((.((((((..(((.......))))))))},,..,..(((..((((.(.((((((.,...,.)))))).).))))....((({....}})),,....))).....((((((,((((((({{(((..((((.(.((((((.{{....}}.)))))).).))))....((((....))))......}}}}},.|||,.......,,)}}..}))))))))))))...(((((((((....))..}))))))))))))...))))))))))...............(((((((.((.(((.....(((((((....................)))))))..))).)))))))))))).)))))))).))..))))))))....}},.................)))))))).))))))).)))|(((((.....)))))}......(((.(((..(((((..((((((.....(((((....))).)))))))))))))..))))))(((.(((((.......)))))...))).))))...}}.))))))))|((({{.........}}))),...}))))))))))............{{{((((({...,{,|..{{|||...,,.((((((((((.....))))).))))){{,,...,,,,{..{{((({........}|||}|,,{{{,.((({.((((.....)))).))))..}}|||,(((((..........(((((....))))).,..{,.((((((.((.....))))))))}),))))).}},.(((....)))....((((((.(((((((((........)))))......))))..)))))}.,|{|{|,,.{{|....}},.,,}})).....))))))))).,||{{,,.})),.,..,,))))).)))))))..))))))))))))...,,.....((({,((......))))))))).)))).)))),})))..)))))))...(((((.(((.....))).))))).,,,..(((.((((((..........)))))).))).{(((..(((((......)))))..)})}.{((((((((.{....,.)))))))))...,,,|{({{((((({....))))}})))((((((.((((((((.((......}}..)))......))))).))))))(((....((((({....))))))...)))))))).)....)))))))......)))))))))....)))).))))))))....)))))))))).)))))..))))..))...,.,.))))..))))))))))))|((.(......}.}.,.,,)))))))))))((((((((,{{,.....,}},..}))).))))..)))).)))))))))).))))).)))))))))))),)})))))))))})})))}),)))),))),).)))((((({,,.,{(((((({{{{|{{{(((({..,,,.....||}{((..((.((((...(((((((((((.{....}.))))))))))).....)))).))..)))))}}}}|.{,((((..((((...({...|}|.}|||..}}}}((((..........})))...{{{{{{({{,.....))))}...,))))|{(((({..{((.........................}}}....)))))))....(((((((((.....(((((....)))))..))))))))))}})))))|{({,(((,,,,|}}}}),,,}})))))|}.,))))))(((((.(({....))).))))).))))))))))}))))))).})))}..|||||.,,,..)))})}))},.,}}},.{{.,(((((((((.,.......,...,,.................}},..,........))).))))))..}}..}))))))))))},)))}}................,,((((((((...)))))))).((({(((((((((((,((((.(({{.{,,,|||||||||..((((((((((((((({{((((...{(((.{{{.(((((....))))){{{((((,......,,..(((.(((..((.((.((((((((((((.((((((((.(((((((((..,......,,..(((((((((........)))}}))))).,,.(((((((.,..(((((((....)))),).)).,)))))))((((.(((((......)))))))))...(((((((({((((..(......)..)))).}))))))))...(((((...))))).....((.(((((((...,(((((((((.(((((.....(((((((,((((..((.,....|.}}..}}},......,.....{{.(((((((...))))))).}}.......,(((((({.(((((((((.......,,,...,{{((,...,|,,.....,})))(((((((....)))))))))))))))).})))))).,.,},..,,,,,.,,))))))))))))..))))).)))),...))))))).)),..)))))))))...)))))))))))))))))))).)).)).)))))).))})))}((((((,(((({..{(((((((((((.......))))))))).))),)))),.,{{....}},})))))..{((((((..((((((...))))))..)))))))..{(({.(((...,............))).))))..((((((((......))))))))......,,,|}).}))),))))))))).))).)))))))),|||}}..||||{((,({({(((..(({((({.{{....,,||{|||||.|||,,},,{{.{{{{{{{((((({,((((((....))))))...,,{..,|||||}|||||||}}..,,,...,{|||{,,|||..,|||,||,|}|||(((({{.......)})))),,,,,.,........,,}|||||}}}}}}}}}).....}..||||}.}}},...,},,,,))}.}}.....{((((....)))))}}}}..|||.}|}}},}}))))))..,,)})}||{{{{{...{.{{{{{{{|||||...,,,||{|||,,,,,.}}}||(((.((((((({....})))).))).))))}(((((((.........((,{(({.((((..((.....))..)))).}))))))))))))......(((((....))))).(((((((....,..,{.((((.....)))),),......)))))))..}}))))},)))}}),}.|||||{||}},,...}))}})))))}}}}.,.}||||((,,.}||,|||((((((((.{,{{{}}}..,|||,...((((((.((....)))))))),.|||{||}|}}{{||||}}}},..|||}......,,||}.,,.||||||,}||||}||||||||,.|||}..)))}}))))))}}}.(((((,...,)))))..,,})))}),},,,.....})))).))))))))))..,,,,,,))}.))))))})},.}))))}(((((({{{,,..((((({|(({|((((....))))|(((((((.((...}).)}|))))}((((.(((.....))).))))}))))))))}}}...)))))),,,.......)))))))))))}.))|,,{{{(,({{{,{|||{.(((((,,.,},,,,})}))))),|,|)}}))}.})))}..))))))))))))}..|||,.||||..||||...))))))).)).}}},.||||....}}}}|.|,..,,.,........}}.)))))).......

Transcripts

ID Sequence Length GC content
GCACAACACAAGGAGAAACUUGGUGUCCAGGGGAGGCCCCCGGCGGCUG… 5789 nt 0.4961
Summary

This gene encodes a member of the BCL-2 protein family. Members of this family are involved in activating or inhibiting apoptosis. The encoded protein localizes to intracellular membranes. This protein promotes apoptosis by interacting with the apoptotic inhibitors BCL-2 and BCL-X(L) via its BH3 domain. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]

Forensic Context

A study in mice demonstrated that the HRK was downregulated 12.089-fold in skeletal muscle at 12 hours post-incised injury compared to controls, as identified through DNA microarray analysis [Mohammed Hassan Gaballah et al. DOI:10.1016/j.forsciint.2016.06.027]. In human cadaver liver, the HRK was found to be downregulated -2.9629 fold in decaying tissues compared to a control, as part of a broader apoptotic thanatotranscriptome analysis using PCR arrays [Javan et al. DOI:10.1007/S12024-015-9704-6]. A study in mice demonstrated that the HRK was downregulated (12.089-fold at 12 hours) in skeletal muscle following an incised injury, as identified through DNA microarray analysis [Gaballah et al. DOI:10.1016/j.forsciint.2016.06.027].