Basic Information

Symbol
HSBP1
RNA class
mRNA
Alias
Heat Shock Factor Binding Protein 1 Nasopharyngeal Carcinoma-Associated Antigen 13 Heat Shock Factor-Binding Protein 1 NPC-A-13 HSF1BP
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_001537.4
Sequence length
8649.0 nt
GC content
0.4409

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2718.40 kcal/mol
Thermodynamic ensemble
Free energy: -2874.16 kcal/mol
Frequency: 0.0000
Diversity: 2035.10
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((((........)))))..))))).(((...((......))..)))(((((((((((((((((((((....(((......))).(((((((((((((...((((((((((((((...(((((((.((((((.....)))).))....)))))))((....))..........((((((...))))))(((((((((((.((..(((.((...)).)))..)).))...)))))))))...........(.(((..(((((.((.(((((((((.((((..(((....))).......((..((((.(.((........)).).))))..))............(((((..........)))))(((((.((.....))...)))))((((((((((((((((((.(((.....(((...((((((....))))))...)))...))).))))....)))))).))))))))....)))))))))))))..))..)))))..))).)...)))))).....))))))))..)))))((((......(((((((((.(((((((((...........)))))))))..)))))))))......))))..............(((....((((((((((((....))))..(((.(((.((((((...(((((((((((((.............(((.....((((....))))...)))..(((((((.((..((.(.(((((((((..(((((.(((((((.((((......)))).((((((((........))))))))............((..(((((((((.........))))..)))))..)).(((.(((((....(((((((....(((((....(.((((((((....)))))))).))))))(((((........)).)))...(((.((((((((((.((((((((((.(((((((((.((((.((.....((.((((((.....)))))).)).....)))))).)))))))))))))))))............(((((......)))))(((((..(((......))).)))))..(((((((....))))))).....((..((..((((((.(((((((....).))))))..))))))..))..))..(((((((((((((..(((((((((.((.(..(((((((((((.((((..((((((.((....)))))))).........((((............((((((....((((.(((((...)))))(((((((....)))))))..))))))))))((((((.....))))))(((((.(((((....)).)))))))).))))...((((((..((((((((((((.(((.(((..((((((..........)))))).....(((......))).......(((((((((((((((......)))))))))))).))).....))))))))))))))..............(((((((.......(((((((((.....)))))))))..((((..((.....(((((((((....)))((((..........)))))))))).))..)))).............)))))))..))))..))))))..((((((((.((((.......(((((..((.......))..)))))..........))))...))))))))..)))).)))))))..))))..).)).)))))..))))..))))))))(((....)))..((((((((((.((((((((((..(((((((...(((.........))).)))))))...((((((....)))).)).......((((((((((((((.(((.((.........(((....))).((((((((.((((......((.((((((.((((((((......(((..(..(((((((............(((((((.(((..............(((((.((((..((((((((((((.(((((((((((((((((((.((.(.(((((.....(((.(((((((..(((..(((((....))))).(((((.(....(.((.((((.((((((...))))....)).)))))).)).)))))((((.(((((((((..((((....(((((((.(.((...))).)))))))......((((((((((........(((.....))).((((((................))))))...)))))))))).(.((((((((((((((((((((((((((((((((((((((.(((.(.(((((((.(.(((....(.((((((((.((((((.((((((((.((((((((((((.(((((((...(((((((((.(.(((((((((.(((((((.(((((((((((.((((((((((.((((((((((.(.((((.(..((((..((((.(((((((((((((((((((((((((((..(((((((..((((((.((..((((((((((((((((......)))))(((((((((((((..(((((((.(((...(((((..(.((((...)))).).)))))))))))).)))..))).)))))((....))...)))))..(((((....(((((....)))))....((((((...((((.(((.................(((((.....((((((((((((......))))...)))))((((((((((((((.((((((((((((((.(((((....(((((......)))))((((((((.(((((.........((((((..(((((.........(((((...)))))........)))))))))))(((..........))).(((.((((.....(((((((((((((.((((((....(..(((..((((((....((((....))))......)))))).....)))..).)))))))))).)))..))))))..............((((((((.(((...(((((((((...)))))))))....))).))))))))))))))).....(((((..((((.((((((((....))))))....)).))))..))))).........))))).))))))))....((((.((.((((.((((.....)))))))).)).)))).....(((((...((.((.(((((((((((((..(((((((((.(((((((((((((((((((((((((((((((.(((((((...((((..((((((....(((.(((........))).)))))))))...)))).....)))).......((((((.........))))))(((((.......((..((((...((((((..(((....(((.((((....)))))))...)))....)))))).))))..))......)))))(((((((........))))))).(((((.....)))))....(((((((....(((.(((((......)))))...)))...)))))))((.((((((......))))))..))......(((((((.((((.(((.....))).)))))))))))((((.......)))).((((((((((......(((((((.(((.((.((.....(((((..((.....))..))))).....)).))..((((((............)))))).))))))))))..(((((((..........((((((.....(((.((....))))).....))))))...(((((...(((......)))...)))))......((((((.............))))))...)))))))..))))))))))...((((....))))....))))))))))))))).))).)))))))).................))))))))))))))).((((..(((.....)))..))))....(((((((((..(((......)))..)))).))))).))..))))))))))))).))..))....))))).((((..((((..(((((.((..(((..((((..((...))..))))..)))..)).)).)))))))..))))..))))).))))))))))))))....(((((((....)))))))....))).)))))))))))...))).....))))))))))))........))))))(((((((((((......)))))....(((((((.((((((((.((((((....)))))).)))..)))))..).))))))))))))(((((((((((((((((((.(((...((((..((.(((((......(((....)))..((((((((((((...........)))))((((((..............(((((........)))))(((......)))))))))((((.....)))).))))))))))))))..))))))).))).))))))))))))))))....)))))....(((((..(((.(.((...))).)))..)))))..(((((...(((((.(((((.....(((..((((..........))))...))))))))))))))))))...((((((.......))))))..((((((((.(((...((((....))))((((.((.((((....((((((((((...(((((((((..((((..(((((((((((((((...((((...))))..)))))))))))))))))))...)))))...)))).......(((((......(((((.........(((((........((((....(.(((((((...))))))))..))))))))).....((((....))))...........)))))......)))))))).)))))))......)))).))))))...))).)))))))).((((((.(((......)).).))))))........)))).))))))))).))))))..)))))))..))))))))))))))))))))))))))).)))).....))))..).)))).).)))))))))).)))))))))).))))))))))).)))..........((((...........)))).)))).))))))))).).)))))))))...))))))).)))))))))))).)))))))).)))))).)))))))).)....))).)))))))).).))).)))))))))))))))))))))))))))))))))))))).)...........................................)))).))))))...))).))))...((((.(((((...((((((((.((.(((..(((((.((((((.....)))))).)))))))).)))))))))).))))).)))))))..))))))).))).......)))((((((((((((.(((((((...........))))))).)))))).......))))))((((....))))(((((((((((((((((....((......))....))))))).)).)))))))).)).).)))))).))).)))).))))).........))).)))).(((((((.(((..(((((((((((((((((((.......((((((.(((..((..(((((((((((((....(((((.((....((((((..(((......)))))))))...))))))).))))))))....).))))...))...))))))))).....((((.....)))).(((((((.((((.......((((((.......))))))..........)))))))))))..((((((((.............))))))))...((((((((.(((((...(((...(((...(((((....(((((.....((((((..((((.((......((......)).......)))))).))))))...(((((.((((((((.((((.((...)).))))))))).))).))))).........)))))....)))))...)))...))))))))...)))))))).....))))))))).....((((((((((.......))))))(((((...))))).....)))).......((.(((((..(((((...........((((((...))))))............)))))..........((((((.........)))))).....(((((....)))))))))).))..))))))))))..)))..))))))))))))))).)))).)))))(((((..((((.....))))...)))))..............))).)))))))..((.(((((((.((((.....))))..))))))).))..(((.......))))))))))..)..)))......)))))))).))))))..)).(((((...))))).........(((((((.(((..((((((........)))))).))).....((((((..(((((.((((...))))..))))).)))))).((((.....))))(((..(((((((((...........))))))))).)))..((((.((((((((..........((((((......))))))))))).))).))))....))))))).......(((((((...)))))))...)))).))))))))..)))))...))))))))))..))))..(((.(((((....))))))))...((((((...(((((((..((((((.....((..((((((((((((...((((((..((((.....))))...))))))((((((....((((....))))..))))))..............))))))))))))..))))))))..).))).))).....(((((.((((..(((((..((((((.((((((((.((((....((((((.((((..(((((((((((((((.......))))))).....(((.(((((.......))))).))).((((...))))((((((((...)))..))))).......((((..((.(((((((...)))))))..))..))))..((((((((.....((((((((....(((......)))......)).))))))......))).)))))))))))))...(((.....)))((.((((....(((((..((...))..)))))..)))).)).))))))))))...)))))).)))))).))))))...))))).)))))))))((((.((...)).))))...((((((((((....((((.....))))......))))))))))........(((((.(((..............((.((((......)))).))........((((.(((.(((..(((.(((..((..((((..((......))...)))).)).))).)))..)))...))).))))..((((((.........))))))....))).)))))((((.((.(((((..(((((((........))))...)))))))).)).)))).))))))))))))))))...((((((...)))))).)))))))))))))))..(((((..(((((.(((.....((((((((..(((.(((......)))...))).))))))))................((((.(((....))))))).))))))))..))))).)))))))))))))))..................)))))))((((((((.((((((........(((..(((.((..(((((((.((((((..((((.((....(((.....)))))))))))))..))..)))))))..)).)))..))))))))).)))))))).))))).)))..(((((((((((.((.(((.(((((((..((((((((((((...)))))))))))).((((....))))((((((.....((((.((((....((..((((....)))).))..)))))))).((((((((((.(((((...((.(((((.(((...)))...))))).)).)))))))))((((.((......((((((((......))))))))....)).))))((((((.(.(((.((.......)).)))).))))))(((((((((((((.(((((((...))))))).)).(..(((((.((((.......(((((.......))))).......)))))))))..)))))))))))).)))))).(((.(((.(((((.............))))))))))))))))).)))))))...))))).))))).))))))..))))...))).)))))..)))))))))).))..)).)))))))............))))))))))))).)))))).)))..)))))))))))....)))..........)))))))))))))))))...........(((((...))))).(((((((((.(((.(((...(((((...)))))....)))))).)))))))))...))).))))))))).
Thermodynamic Ensemble Prediction
.((((((((((........))))).,))))).(((...((......}}..})){(((((((({({{((({{{{{,,..{{{..,,,,|||,(((((((({((((...((((((((((((((..,(((((((.((((((.....)))).))....))))))){{....}}..........((((((...))))))(((((((((((.((..(((.({...}).)))..)).)}..,))))))))).........,,,.||,..{(({(.,,.{((((((((.(((({.((({{{{{({,......{(..((((.,.((.,......)).}.)))).,||.....,,,....,{|||,.},,}}.,}))))|(((((.,,,,...))...)))))}{((((((((((((((((.(((.,,,.(((...((((({....)))))).,.})),..))).))))....))))))}}})))))))..}))))))))))))},.))..)))))},))).,...)))))).....))))))))..))))}{(({......(((((((((.(((((((((...........)))))))))..)))))))))......))))|.............,{{....((((((((({({....|||,..{((.{{{.((((((...(((((((((((({..,{,,,||||,...,{,,,.,{{{.,,.,,||.,,}}}||{{(((({,({,,,,.{.(((((((((..(((((,(({((((.(((({....,)))).((((((((,.....,.))))))))............{{..((((({(((.........))))..)))))..}}.(((.(((((.,..(((((((....(((((....(.((((((((....)))))))),,))))){{{{{........}}.}})...(((.((((((((((.({((((((((.(((((((({.((({.{{.....{{.((((((.....)))))).}}.....}})))).)))))))))))))))))............(((((......)))))(((((..(((......))).)))))..(((((((....))))))).....((..((..((((((.(((((((....).))))))..))))))..))..))..{((({((((((((..(((((((((.((.(..(((((((((((.((((..((((((.((,...}})))))},.....,,,,,...,}}},,,....{((((({{,,{....{((((...}}}}}(((((((....)))))))..,}}}}}}}||((((((.....))))))((((,{(((({....)).))))))))||,||,..{{{{((,,{(((((,(((({{((..(((..((((({.,.......,)))))).....(((......)))..,{{{{((((((,,(,(,,,...,.}..))))))))))).})}..}|||)))),)))))})}},....},,..,,.,,,,{{|}}}},..(((((((((.....)))))))))..{(((.,{(....,(((((({({....}}}{{{{......,...))))}}))}},))..)))}....,,,,..,|,}}}}}}}.,))}}..}))))),.((((((((.((((.......(((((..({.......))..))))).....,....))))...))))))))..)))).)))))))..))))..).)).))))}..))))..))))))))(((....)))..((((((((({.((((((((((..(({{{((,,|(((.........||}.}}|||||.,,((((((,,.,|||}.}}.......((((((((({{{{{.{{(.((,,...,,,.(((....}}}.{{((((((.{(({.,,,,,((,((((((,((((((((..,...{{{..{..{((((((............{|{{{||.{{|,,,....,,,,,..(((((.(({{.,((((((({((((.(({{((((({((((({((({((,{{((({..,,.,(((,(({((((,,(((,.(((((....))))).,((((,,..,,|||{{((((,({((((,,,|}}}.,,.}}.}}}|}||}},))})}((({,(((((((((..((((.,.{(((((((,(.{,...}}}.}))))),}}.|..((((((((((........,{{.....}}}.((((((.{..............))))))...)))))))))),(,((((((((((((((((((((((((((((((((((((((.(((.{.(((((({,(.(((.,..(.((((((((.((((((.((((((((.((((((((((((.(((((((...(((((((((.(.(((((((((.(((((((.(((((((((((.((((((((((.((((((((((.(.((((.{..{{(({.((((.(((((((((((((((((((((((((((..(((((((..((((((.((..(((((((,{{{(((((......))}}}{{{{,,{((((((,,((((({,.{{{...{(({{.,(,((((,,,||||,|,|||||,,,,,||{|||,{|||.||((((((.,.,......|||..((((.(.,,(,{{,....}}))),,)))),},.........)))))},||||||,.,,..{(((((.....((({((((((((......)))}...))))|(((((((((((,,..((((((((((((((.(((((....{((((......))))}((((((((.(((((.........((((((..(((((.........(((((...)))))........))))))))))),||..........,,,.,,{,{,,..,...(((((({((((((.((((((....{..(((..((((((..,{((({....}))}.}.,..)))))).....)))..}.))))))))))}}))..)))))).,,....,,..,,.{{(({{({.({{...{((((((({...))))))))),,,,))}.)))))}}))))}}}},,...(((((..((((.((((((((....))))))....)).))))..))))).......,.))))).))))))))....(((,.((.((((.((((.....)))))))).)).,)))....,(((((...{{.((.(((((((((((((..(((((((((.(((((((((((((((,(((((((((((((((.(((((((,..{(((,,((((((....{((.(({...,....))).}}}}}}}}|,..}}})}}.|}{{{{,,,..,,((((((,........}||||}(((((.......((..((((...((((((..(((....(((.((((....)))))))...)))....)))))).))))..))......)))))|||||{{........})))))),(((((,...,)))))...((((((((....,((.{((({......})))},,.,,,...))))))))|.((((((......))))))..,.......{{{{{{{.{{{{.{{{.,..,))),))}}}}}}}}}((((.......}))).{(((((((((.....,{(((((,|(((....{{.....,,(((,,,,.....,|..))))}.....}}.,,..((((((............)))))).)))))))))}..(((((((..........((((((.....((,{((....))))).....))))))...(((((...(({......}))...)))))......((((((.............))))))...)))))))..))))))))))...((((....))))....))))))))))))))).))).))))))))},...............})))))))))))))).((((..(((.....)))..))))....,{(((((((..{{{.,....}))..)))}.))))}.))..))))))))))))).))..))....)))))}((((..((({.,(((((.((..(((..((((..((...))..))))..)))..)).)).)))))))..))))..))))).))))))))))))))....{{,((({....))))|||,...)))})))))))))))...))).....)))))},((((((,......{({{....,.},(((((......))))).......}}}|}|{(((((,.,,)})}).}}))))}}.|||||||||}}|}|},|||{{{{{|{(((((((((((((((((((.((({,.(((({,((.{{{||}}},}},,,,},,)}}{{((({{{{||||||,,,{.,.....,})))})}}...............{((((........))))}||,||||,.,,,))))))||{{.....)))}}))))))})))}}))}})}}}))).))).)))))))))))))))),..,||}}|{{,.(((((..(((.,.((...,)).)))..)))))..,|||}.{((((((.(((((.....(((..((((..........))))...)))))))))))))))}},...((((((.......))))))..{{{{{|||,|||,,.((((....)))){{{{,{,.{{{{....,,,,,,{|||,||||.....(((.(((,.,(((((((((((((((...((({...})))..)))))))))))))))))))))}.|||{{....((({..({(,,.,({{....}}).}.}}}...})))...}}}}}...||||,,}}|.|||||{,.,,))}}}}}|.{||,,,,}}}||{,.((((....))))........|{{|||||......,}||||||.,,}})}}......))}}.},}))),,.,)),)))))}||,((((((.(((......)),).))))}}........}))),))))))))).))))))..)))))))..))))))))))))))))))))))))))).)))).},,.}}}}..}.)))).).)))))))))).)))))))))).))))))))))).))}..........{{{,...........}}}},)))).))))))))).).)))))))))...))))))).)))))))))))).)))))))).)))))).)))))))).)....))).)))))))).}.))).)))))))))))))))))))))))))))))))))))))).............................................)))).})))))...}}}.}}}}..,|({{.(((,{,..((((((((.((.{{{.((((((.((((((.....)))))).))))))}}.)))))))))).})}}}.}}))))}..}}}}})},||}.......}}}||||{(((((((.(((((((...,......,))))))).))))))),...,}})))).{|||.,..}}}}(((((((((((((((((..,.((......)),...))))))}.)).)))))))).|}.,|},|})),)}}}}|)).}))}}..,,,.,,.}}}.)))),(((((((.(((..(((((((((((((((((((.......((((((.(((..((.,(((({((((((((....(((((.((.,{.((((((,.{((......)))))))))}}.))))))).)))))))).||,,.,}}}...))...))))}})))...,,||||,,...}}}}.((((((((((((.......((((((.......)))))).......,..)))))))))))..(((((({{..,,,,......,))))))))...((((((((.((((({..,((...{((...(((((....(((((.....((((((..((((.((......((......)).......)))))).))))))...(((((.{(((((((.((((.({...}).))))})))).))}.))))).........)))))....)))))...)))...))))))))...)))))))).....))))))))).....((((((((((.......))))))(((({...})))).....))))...,...{(,(((({.{(({{{{{,........((((((...)))))).....,,,...,}}},,,{{.,.|...|{((({..,,,....}))})),,,},))))})})).}}}}))))).))..))))))))))..)))..))))))))})))))).)))),))))){{|||,.|||{...,,}))}.,.})))).....,,,,.....}}}.}}))}}|{,,{.(((((((.((((.....))))..))))))).}}..(({.......}})}}}}}}}.,|,.|||...,..}}}}}}||,||||}},,||,(,,((,,,.,,||.......,,(({{,,,..|}},{{{{{|,.,,,,,.)))))).,))}}}}}((((((..(((((.{{{{...}}}}..))))).)))))}.((((.....)))}{{{..{{(({({{(,,,...,....}}))}}))}.}}},.{{{{,{{{{{(((..........((((((......}))}})}}}}|.}}}.)}},....,))}|||..,||.,((((({(.,,|})}}}|,,.}}}}.})))))))},))))),,,)))}))))))..|||}..(((.(((((....))))))))....{||{{{,...,,|||.,|{||||},,,.||,,((((((((((({..,((((((..((((.....))))...))))))((((((....((((....))))..))))))..............))))))))))))..,}||||||.||},.,}}|}},..,(((((.((((..(((((..((((({.(((((({{.((((....((((((.((((..(((((((((((((((.......))))))),,.,.(((.(((((.......))))).))).{({{...,}}}((((((({...}))..))))).......{((({.{(.(((((({...))))))).}}}..,))),.{(((((((.....((((((((....(((......))),.....}}}})))))......))).))))}))))))))...(((.....)}}((.((((....(((((..{{...))..)))))..)))).)).))))))))))...))))}}.)))))).))))))...))))).)))))))))|(((.({...,).)))}...|{{{{({{{{||,,||||,...,}})},|,,,,|}}}}}|||||{{,,,,,|{{{{,,,,,,}},.,,......||,|{{{......}))).)}...||}}}|}}||,,||||.,.,..}|})}|||,|,..,,,||...,.,|}|||,,,,,}}}||,.,|||{||||,.|||,||||.,||}}}|,})).,}}.)))))),,,}}),)}))}}||,,}||}|||||}||.,||{{,,,,....)}})..,|}|}})},,)).})))})}}}}.)))))))))),{,{{((({...))))))))))))))))))))))..{((((..(({{{{(({....,{(((((((..{((.(((......)))...}}).))))))),.,,.............(({{{(((....))))))).))))))))..))))),))))))))))))))).......||,....,,,.))))))){(((((((.((((((........(((..(((.((..(((((((.((((((..((((.((....{{{.....)))))))))))))..}}..)))))))..)).)))..))))))))).)))))))),))))).))),.(((((((((((.((.(((.((((((({{((((((((((((...)))))))))))).((((....))))((((((.....{(((.((((....{{..((((....)))).}),.)))))))}.((((((((({{(((((...((.(((((.(((...)))...))))).)).)))))))))((({.((,{....((((((((......))))))))....)),))))((((((.{.(((.((.......)).)))}.))))))(((((((((((((.(((((({...})))))).)).{..(((((.((((.......{((((.....,,)}}}}.,,....)))))))))..)))))))))))).)))))).(((.((,{(((((.,......,....)))))))))))))))))))))))))...))))).))))).))))))..)))).,})},.)))))..)))))))))},.,.,)),))}}}},.....,,,.,,.))))))))))))).)))))).}},.,)))))))))))....}},..........)))))))}})))))))),,.........(((({...})))).(((((((((.(((.(((...{(({{...}}}))....)))))).)))))))))...,,,.))))))))}.

Transcripts

ID Sequence Length GC content
AGUCUCGUCGCGAGAAGCAGCGGCCCGGGGCGACUGAGCGGACAAACGG… 8649 nt 0.4409
Summary

The heat-shock response is elicited by exposure of cells to thermal and chemical stress and through the activation of HSFs (heat shock factors) results in the elevated expression of heat-shock induced genes. Heat shock factor binding protein 1 (HSBP1), is a 76-amino-acid protein that binds to heat shock factor 1(HSF1), which is a transcription factor involved in the HS response. During HS response, HSF1 undergoes conformational transition from an inert non-DNA-binding monomer to active functional trimers. HSBP1 is nuclear-localized and interacts with the active trimeric state of HSF1 to negatively regulate HSF1 DNA-binding activity. Overexpression of HSBP1 in mammalian cells represses the transactivation activity of HSF1. When overexpressed in C.elegans HSBP1 has severe effects on survival of the animals after thermal and chemical stress consistent with a role of HSBP1 as a negative regulator of heat shock response. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the HSBP1 was identified as a differential wiring hub node in the purple module within the nucleus accumbens of selectively bred lines with high or low risk for voluntary methamphetamine intake [Hitzemann et al. DOI:10.3390/brainsci9070155].