Basic Information

Symbol
HSD11B2
RNA class
mRNA
Alias
Hydroxysteroid 11-Beta Dehydrogenase 2 SDR9C3 Short Chain Dehydrogenase/Reductase Family 9C Member 3 NAD-Dependent 11-Beta-Hydroxysteroid Dehydrogenase Corticosteroid 11-Beta-Dehydrogenase Isozyme 2 11-Beta-Hydroxysteroid Dehydrogenase Type II 11-Beta-Hydroxysteroid Dehydrogenase Type 2 11-Beta-HSD Type II 11-HSD Type II 11-Beta-HSD2 HSD11K 11-DH2 Short Chain Dehydrogenase/Reductase Family 9C, Member 3 Hydroxysteroid (11-Beta) Dehydrogenase 2 -HSD11 Type II EC 1.1.1.- EC 1.1.1 AME1 HSD2 AME
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_000196.4
Sequence length
1896.0 nt
GC content
0.6324

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-783.50 kcal/mol
Thermodynamic ensemble
Free energy: -814.94 kcal/mol
Frequency: 0.0000
Diversity: 430.83
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((.......)))))(((...((((((.((........)).))).)))..))).((((((.....(((((((((((((((((..(((....)))..))).((.(((((....))))).))((((((((..((((.(((((((((((((((((.....)))))))(((((((((.(((((((((((((((.(.((.((((((((....)))))))))).).))))).)))))))).((((((((.(((.((((.((...(((.(.(.((((((...(((((..((.(((((((((.....)))).))))).))..))).))...)))))).)).)))))))))))).)))))))).)).))))))))).....(((((.....)))))((((.(((....))).)))).....))))))))))...)))).))))))))((.(((((((((.((((.(((((((((.(((....))).)))))))....((((((((((.((((.((...(((......)))..)).)))).....((((.......)))).....(((((((((((((((((((((((.((((((.(((..((......))...)))))))))(((.....)))..((((((..((.(((((((.(......).))))).)).))))))))....(((((......)))))))))))...)))))))))))..).))))).((.((((.....)))).)).))))))))))..)))))))))))))))..)))))))))...).))))))............(((((((((((..((((((.(((((.(((.(((((.((.(((....(((....)))...((((((...((((....((((((((..(((((((.........(((.(((((((((.((.((((..(((((((((((((((((((((((.((..((....))..)).))))))))).....((((((.(((((((((((((((((..(((((..((......))..))))).))))).....)))).....(((((.((((...((........))..)))).)))))..((((((...)))).))....))))))))(((((.((((..(......)..))))..))))))))))).)))))..)))............(((...((((((((((((.(......))))))))))))).....))))))))))))).)).)))....)))))).)))....))))).))))))).))).)))))))))).((((.......))))))))))))))))).....(((((((((.((...((((((......)))))))))))))))))......))))).))))))(((((((((((................((((((((((((((.......(((((.(((((..(((((.....(((...(((((.((((.((.....((((..(((.......))).))))(((((((((((((......)))))).)).)))))((((((((.....((((........((....))......))))......))))..)))).......)))))))))))(((((......)))))...(((((((((.....)))...)))))).((((((....))..)))).))).....)))))))))).))))).......))))))).....((((....))))..))))))).))))))))))).........((((...(((...(((((........))))).)))..)))).)))))))).))).((((((.((.....)).))))))..............(((((((((....)))))))))))))))...
Thermodynamic Ensemble Prediction
({{.(((((.......)))))(({...((((((.((......|{},.}}),))},,)))||((,,({,,...{{((((((((((((((..(((....||}..|}}.,(,{{{{{...,)))))})}((((((((..({({.(((((((((((((((((.....)))))))(((((((((.(((((((((((((((.(..(,((((((((....))))))))})),.))))).)))))))).((((((((.((,{((((.{{...(((.(.(,((((((...(,(((..((.(((((((((.....)))).))))).))..))).}|,..)))))),)).))),)))))))).)))))))).)).))))))))){((({(((((.....))))),}.)))}.{{{.|{....})..)}.))))))))))...)})}.)))))))){|.(((((((((.((((.(((((((((.(((....})).)))))))....((((((((((.((((.((..,({{......}))..)).)))).{{..((((.......))))...},|((((((((((((((((((((((.((((((.(((..((......))...))))))))){((.....}))..((((((..,(.((((((({(....}}),})))).)).}}))))))....(((((......)))))))))))...)))))))))))..).))))}.{{.((((.....)))).)}.))))))))))..)))))))))))))))..}}))))))){{{|{||||||{{{,.....,{.(((((((((((..,{((((.{{{||.{{(.(((((.((.(((....,((,...},}.,.((((((...((((....((((((((..{{(((((,........(((.(((((((((.((.((((..(((((({{,{{((((((((((((.((..((....))..)).))))))))).....((((((.(((((((((((((((((..(((((..((......))..))))).))))),{,....||.....(((((.((((...{(........)}..)))).))))).,({{(((...))))}})))).))))))))(((((.((((..(......,..))))..))))))))))).}}}}}..,}}....,,,.....{{{...((((((((((((.{......})))))))))))).....}}})))))))))).)).)))....)))))).)))..}.))))).}}))))).))).)))))))))).((((.......))))))))))))))}}}.....(((((((((.((...((((((......))))))))))))))))).||...}}}||,||}}}|{(|({{{{{|||..,.,,|....,},|||||||,,,|||.......}}}|||||({{{,,{(({{...{...........,..||,..||....,((((,,{,,..,,,..))).)))}}||||||||||||..,.,.}))))).}).)),{(((((((((.....((((........({....))......))))......))))..)))))}.,}})))))),.))))||{{{......})}}}...(((((((((.....)))...)))))).,{{{,,,|,|}},......))))}.,))))|{||,{(((((.,.{{{{{,|||{{||..,,.((({....}}}}..,)})}}),}}))))))),..........({((...{{|...(((((........))))).}}}..,}}}.})))))),)))).((((((.{{.....}}.))))))..............{((((((((....))))))))),))).....

Transcripts

ID Sequence Length GC content
GAAAGCGAGUGUCCCUCUCGCGCCCCAGGCCGGUGUACCCCCGCACUCC… 1896 nt 0.6324
Summary

There are at least two isozymes of the corticosteroid 11-beta-dehydrogenase, a microsomal enzyme complex responsible for the interconversion of cortisol and cortisone. The type I isozyme has both 11-beta-dehydrogenase (cortisol to cortisone) and 11-oxoreductase (cortisone to cortisol) activities. The type II isozyme, encoded by this gene, has only 11-beta-dehydrogenase activity. In aldosterone-selective epithelial tissues such as the kidney, the type II isozyme catalyzes the glucocorticoid cortisol to the inactive metabolite cortisone, thus preventing illicit activation of the mineralocorticoid receptor. In tissues that do not express the mineralocorticoid receptor, such as the placenta and testis, it protects cells from the growth-inhibiting and/or pro-apoptotic effects of cortisol, particularly during embryonic development. Mutations in this gene cause the syndrome of apparent mineralocorticoid excess and hypertension. [provided by RefSeq, Feb 2010]

Forensic Context

No relevant information is available at the moment.