| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAUUUGAUGCGACGGCCUCACGGGGCUUUGGAGGUGAAAGAGGCCCAGA… | 1050 nt | 0.6114 |
17-beta-hydroxysteroid dehydrogenases, such as HSD17B14, are primarily involved in metabolism of steroids at the C17 position and also of other substrates, such as fatty acids, prostaglandins, and xenobiotics (Lukacik et al., 2007 [PubMed 17067289]).[supplied by OMIM, Jun 2009]
A study in human postmortem brain tissue demonstrated that the HSD17B14 was identified as the top differentially expressed transcript associated with microglia in subjects with opioid use disorder, showing reduced expression in microglia in OUD subjects compared to unaffected controls [Seney et al. DOI:10.1016/j.biopsych.2021.06.007].