| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCAGUUGGGGCAGGAGGAAGCCGACUGCUGCCUGGUCUGCAAAGAAGU… | 1512 nt | 0.4484 |
The protein encoded by this gene has both oxidoreductase and epimerase activities and is involved in androgen catabolism. The oxidoreductase activity can convert 3 alpha-adiol to dihydrotestosterone, while the epimerase activity can convert androsterone to epi-androsterone. Both reactions use NAD+ as the preferred cofactor. This gene is a member of the retinol dehydrogenase family. [provided by RefSeq, Aug 2013]
A study in Apoe-/- mice demonstrated that cigarette smoke exposure induced dysregulation of lipid and bile acid metabolism, with the HSD17B6 being downregulated in the liver, an effect that was reduced upon switching to a candidate modified risk tobacco product or cessation [Lo Sasso et al. DOI: 10.3109/08958378.2016.1150368].