Basic Information

Symbol
HSD17B8
RNA class
mRNA
Alias
Hydroxysteroid 17-Beta Dehydrogenase 8 SDR30C1 RING2 HKE6 D6S2245E H2-KE6 FABGL KE6 3-Ketoacyl-[Acyl-Carrier-Protein] Reductase Alpha Subunit Short Chain Dehydrogenase/Reductase Family 30C Member 1 3-Oxoacyl-[Acyl-Carrier-Protein] Reductase 17-Beta-Hydroxysteroid Dehydrogenase 8 (3R)-3-Hydroxyacyl-CoA Dehydrogenase Testosterone 17-Beta-Dehydrogenase 8 Estradiol 17-Beta-Dehydrogenase 8 KAR Alpha Subunit 17-Beta-HSD 8 Protein Ke6 FabG (Beta-Ketoacyl-[Acyl-Carrier-Protein] Reductase, E Coli) Like (E. Coli) Short Chain Dehydrogenase/Reductase Family 30C, Member 1 Hydroxysteroid (17-Beta) Dehydrogenase 8 Really Interesting New Gene 2 Protein Estrogen 17-Oxidoreductase EC 1.1.1.N12 EC 1.1.1.239 DJ1033B10.9 EC 1.1.1.62 FABG Ke-6 Ke6
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_014234.5
Sequence length
977.0 nt
GC content
0.5885

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-399.00 kcal/mol
Thermodynamic ensemble
Free energy: -416.80 kcal/mol
Frequency: 0.0000
Diversity: 260.87
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((..(((......)))...((((((((.(((((..(((((((((...((((((((((((.((((((((((.(((.((...((((...(((((((.......))))))).......))))...)).))).))))).))))))))))((((((.((((.(....).)))).))))))....))))))))))))..))))..((((((((((.((((((((((.(((...(((((......)))))(.((((((((.((..((.((((((..........))))))))))...........(((((((...((.((((((.....)))))).))...))))).))...(((((((...(((((((..(((((((((.........((.((((.........)))).)))))))))))))))))))))))))...)))))))).).....))).).))))))))).)).....(((((((((.....((((...(((((((...(((((.((((..........(((.(((..(((((..((..(((((....)))))))..)))))..)))))).(((((((((((...))).))).....)))))..(((((((((...(((.....(((((.........(((((((...((((((.......))))))....((.((((...))))))((((((....))))))..)))))))((((((.((((..((((........))))..)))).))))))..(((((((((((((.....)))).))))))))))))))....))).....)))))))))..)))))))))..)))))))......)))).....))))))))).(((((...))))).............)))))))).......))))).)))..)))))...))))..(((((((.(((((.((...........))))))).....)))))))..
Thermodynamic Ensemble Prediction
.{{{,..(((.,....|||,..{(((((((.((((({.(((((((((,,.((((((({((((.((((((((((.(((.{(.,,((((,.,(({{({{.|..,}}})))))).......}}}}.,})).))).))))),}))))))))}{(((((.((((.|....).)))).)))))).,,.))))))))})))..}}}},.((((((((((.((((((((((.(((...(((((......)))))|,{{{{((((.({{{((.((((((..........)))))),,||.......},...,(((((...((.((((((.....)))))).))...))))).||{{.(((((((...(((((((..(((((((((....{,,..,(.{{{,.........))),.,,))))))))))))))))))))))).,})))))))),)},...))).).))))))))).)).....(((((((((....,((((...(((((((...((((((((((.........,(((.(((..(((((..((..(((((....))))}))..)))))..)))))),|.....((((((.,,.{(.({(({((((,,,...||||||}.,..}}....)))})).{,{.....}||((((.....}}})})},},.|||||}.,...,}}||||...|||,|.,((,((((.{{,(((((,{(({((,{{{{{{,||||,,||||,}..,,,.}}}}..||||.|||||}..{((((((((((((,...,))))}})))))))}..,))),,),,))))),)).)))),),.)))))))))..)))))))..,,,.)))).....))))))))).((({{...})}}),..,.........))))))))......,))))).))}..)))))...,|||,.({((({{.{((((.{{...........)))))))})}}}))))))),.

Transcripts

ID Sequence Length GC content
ACCCACAGCCCGCCAUGGCGUCUCAGCUCCAGAACCGACUCCGCUCCGC… 977 nt 0.5885
Summary

In mice, the Ke6 protein is a 17-beta-hydroxysteroid dehydrogenase that can regulate the concentration of biologically active estrogens and androgens. It is preferentially an oxidative enzyme and inactivates estradiol, testosterone, and dihydrotestosterone. However, the enzyme has some reductive activity and can synthesize estradiol from estrone. The protein encoded by this gene is similar to Ke6 and is a member of the short-chain dehydrogenase superfamily. An alternatively spliced transcript of this gene has been detected, but the full-length nature of this variant has not been determined. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the HSD17B8 gene was differentially expressed in leukocytes from blood following injury or lipopolysaccharide infusion, showing downregulation in a burn model but upregulation in both LPS infusion and trauma/hemorrhage models at a 2-hour post-injury time point [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005].