Basic Information

Symbol
HSF1
RNA class
mRNA
Alias
Heat Shock Transcription Factor 1 HSTF1 Heat Shock Factor Protein 1 HSTF 1 HSF 1
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden death from CNS diseases

MANE select

Transcript ID
NM_005526.4
Sequence length
2134.0 nt
GC content
0.6387

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-891.70 kcal/mol
Thermodynamic ensemble
Free energy: -928.93 kcal/mol
Frequency: 0.0000
Diversity: 629.73
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((.((((((((......(((((((((((((((((....))))))((((((.((.((((((((((.(((((((((.......))))))))).((((...))))....)))).))))))..)).))))))((((((((((((((((..((((......))))((((((((......))))))))......((((((((............)))).))))....(((((((...(((...)))...))))))).((((((((((((.(((((((....)))).(.(((((((...((((((.(((.((...((((((((.....))))))))((((.((...(((((...((((.(.....).))))...))))).))))))..))))).))))))...))))))).).....(((((...))))).......)).).))).)))))))))..((((((((....((((((((((((...(((((..((...))..)))))..........(((((((((........)))..))))))....((((.(((..((((........))))))).))))..(((..((........))..)))(((((......)))))..)))))))))))))))))))).......(((((((.((((((.((.((((..((((.((((...((..((((((((.(((...(((((.....((((((.((((...)))).....(((((........))))).....(((((.............)))))))).)))..)))))...((((..((...............))..))))(((.((.....(((((((..((....((((.(((((.......))))).......))))....)).))))))).....))))).))).))))).)))((((((.((.....((......)).....))))))))(((((((((.(((....))).......)))))))))....((.((.(((..((....))..)))..)).)))).))))))))..).))).))...)))))).)))))))..)))))).)))))).)))))))))).)))))........(((((......)))))))).))))).)).)))((((..(((....)))))))......(((((.((.(((((..........))))).))..)))))..(((((.(((((((((..(((.............)))................(((((..(((..(.((((...((.....))...).))))..))).)))))((.(((...((..((((...))))...)).)))..))..((((((((((((((.......)))))...(((((.....)))))..)))))))))))))))))).)))))..))))..(((((((.(((((..(((..((((((((((((((.(((((((.(.(((((((((((((((((((((..((((((..(((((((....(((((((((.......))).((((((.(.(((.((....)).))).).)))))).))))))......(((((((.(..((((((.((.......)).))))))(((((..(((.(((((((((.((((...(((((...)))))((((...)))))))).)))....)))))).)))))))).).)))))))..((........))......)))))))...))))))..)).)).))(((((.....)))))...((((((........))).))))))))))))))))))((......))).))))))).))))))(((((((((((((..((((((.((((((..(((((...(((...((((((.....((((.((((((((...))))..)))))))).))))))...)))...))))))))))))))...))))))((((....)))).....))).)))))))..)))))))))))..)))))...(((.((.(((((((((......(((((((((((.(((((........(((......)))........)))))..))))))....)))))..))))))))).)))))..))))))).....
Thermodynamic Ensemble Prediction
{(((((...,.,||||||({{.{(((((((((((((((((((....))))))((((((.((.((((((((((.(((((((((.....,.))))))))).((((...))))....)))).)))))).,)}.))))))..{(({(((,,....}}},.))}....)))).)))|||||}}}.}}),(((({{((({..((((((((.,........,.)))).))))....(((((((...(((...)))...))))))).}}}|}|.|}}}({((((({,..,,}}}}.||{(({{{{...{((((({((({(,...((((((((.....)))))))),,||,,,..,||,||,,,,{{{,{,.,,}),}))}...}}}}},||||}|{{},,}|{||||}}{,.}}||||,((((((.(((((...)))))..........(((((((({.((...,.((((((((....((((((((((((.,{(((((,,.....|)},},}}...{{,,{,..(((((((((.,....,.)))..))))))..,.(((,.,,|},{,{{,}},,..,|||||}}.},,,..,}}}}||,,,,..,,)}..)).(((((......)))))..)))))))))))))))))))).}..)).))))))))){,((((((.((((.(((((((((((,,((..((((((((.(((...(((((,..,.,(({{..((((...}))}.....(((((........))))),|,..((((({..........,,))))},))})})}.}))))...((({..{|........,{,....))..}))}(((.((.....(((((((..((....((((.(((((.......))))).......))))....)).))))))).....))))).))).))))).)))..)))))),......,...,{{{......,,|.((((((....)))))),,..,|{,.......(((((|.(|...(((((((((.........,{({|{{...,))))}(((((..(((((((({((,..((.((((((...(((....)))....)))))).))...))).))...))))))...))))))))))))))..},.}}}}}.,,.{{.((((..{((....))))))).),...||{||,||,(((((..........))))).))..)))))....})),..)))))))).))))..))))))..))))))....,,,...{{{,...|,|,,||||{{{.{{{{{,,{|}.,......,.}|}},}}}}|}}}}}))}.})}}}||,,|||,...||||,{{{{{{|{{.(((((((((|.,{{....)))))))))))).{{((((({{{{.||||{{.||||||.|||||{{{|,|{|{|,|{{{..((((((((((.(((,({{((,.,({,((((((,,,{,.,{,,,(.(({((((,,,,,,|||||||{{,|},|||||{.,|||||||.,.,((((((((({{...{{|||.{(((((.(,(((.({....}).))).),))))))})}})))},.,},|||{{{|.{{.{(((((.((.......)).))))))}||||,.(((.(((((((((.((((...(((((...)))))((((...)))))))).)))....)))))).))),,)))})})||,|||{{,...,{.,..||,...,.}))}))}...)))))},.||.||.|}{((((.....))))}.,,||,,,,...}}}..))))))))))))))),))),))))}}..,,.))))},,)))}))))))|(((((((((({,.,{{{(((.((((((,.,((((.,.(((...((((((.,,..{(((,(((({(((...))))..)))))))),))))))...)))...))))))))))))))..,|||||,{{{{....))))..,.,,)).)))))))}})))))))))))..))}}}..,{{{.{,.(((((((((.,....((((({{((((.(((,({{{{....{{,.......,}........,))))},))}})),,..))))),.))))))))).,,}))}.))))))).,,}.

Transcripts

ID Sequence Length GC content
CGUUGCAAGAUGGCGGCGGCCAUGCUGGGCCCCGGGGCUGUGUGUGCGC… 2134 nt 0.6387
Summary

The product of this gene is a transcription factor that is rapidly induced after temperature stress and binds heat shock promoter elements (HSE). This protein plays a role in the regulation of lifespan. Expression of this gene is repressed by phosphorylation, which promotes binding by heat shock protein 90. [provided by RefSeq, Jul 2017]

Forensic Context

A study in humans demonstrated that myocardial HSF1 transcript levels showed no significant differences between hypothermia deaths and other causes of death, such as cardiovascular disease or trauma, and no correlation to thrombomodulin levels [Pakanen et al. DOI:10.1007/S00414-014-1138-2]. A separate transcriptomic analysis in human burn patients found the HSF1 gene was upregulated in elderly patients with high total body surface area burns, where it is associated with heat shock protein synthesis [Dreckmann et al. DOI:10.1371/journal.pone.0226425]. A study in human astrocytes demonstrated that exposure to 3 Gy proton radiation significantly down-regulated the expression of 13 extracellular vesicle-derived microRNAs, including hsa-let-7c-5p, hsa-let-7b-5p, and hsa-miR-762, which target genes associated with neurological disorders [Gaines & Nestorova DOI:10.1016/j.lssr.2021.11.001].