| ID | Sequence | Length | GC content |
|---|---|---|---|
| CGUUGCAAGAUGGCGGCGGCCAUGCUGGGCCCCGGGGCUGUGUGUGCGC… | 2134 nt | 0.6387 |
The product of this gene is a transcription factor that is rapidly induced after temperature stress and binds heat shock promoter elements (HSE). This protein plays a role in the regulation of lifespan. Expression of this gene is repressed by phosphorylation, which promotes binding by heat shock protein 90. [provided by RefSeq, Jul 2017]
A study in humans demonstrated that myocardial HSF1 transcript levels showed no significant differences between hypothermia deaths and other causes of death, such as cardiovascular disease or trauma, and no correlation to thrombomodulin levels [Pakanen et al. DOI:10.1007/S00414-014-1138-2]. A separate transcriptomic analysis in human burn patients found the HSF1 gene was upregulated in elderly patients with high total body surface area burns, where it is associated with heat shock protein synthesis [Dreckmann et al. DOI:10.1371/journal.pone.0226425]. A study in human astrocytes demonstrated that exposure to 3 Gy proton radiation significantly down-regulated the expression of 13 extracellular vesicle-derived microRNAs, including hsa-let-7c-5p, hsa-let-7b-5p, and hsa-miR-762, which target genes associated with neurological disorders [Gaines & Nestorova DOI:10.1016/j.lssr.2021.11.001].