Basic Information

Symbol
HSP90AA1
RNA class
mRNA
Alias
Heat Shock Protein 90 Alpha Family Class A Member 1 HSP90N Hsp89 Hsp90 HSPC1 HSPCA Heat Shock Protein 90kDa Alpha (Cytosolic), Class A Member 1 Lipopolysaccharide-Associated Protein 2 Heat Shock Protein Family C Member 1 Heat Shock 90kDa Protein 1, Alpha Renal Carcinoma Antigen NY-REN-38 Heat Shock 90kD Protein 1, Alpha Heat Shock Protein HSP 90-Alpha LPS-Associated Protein 2 Heat Shock 86 KDa FLJ31884 HSPCAL4 HSP90A HSP 86 HSP86 LAP-2 Heat Shock Protein 90kDa Alpha Family Class A Member 1 Epididymis Secretory Sperm Binding Protein Li 65p Epididymis Luminal Secretory Protein 52 Heat Shock 90kD Protein 1, Alpha-Like 4 Heat Shock 90kD Protein, Alpha-Like 4 EC 3.6.4.10 HEL-S-65p HSPCAL1 HSP89A Hsp103 EL52 HSPN LAP2
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Time since deposition estimation

MANE select

Transcript ID
NM_005348.4
Sequence length
3228.0 nt
GC content
0.4160

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-846.88 kcal/mol
Thermodynamic ensemble
Free energy: -910.43 kcal/mol
Frequency: 0.0000
Diversity: 1041.74
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((.((((((((((..(((((((((((((.(......).))))))))))...)))..)))).)))))).)))...(((.((((((.(((.(.(((((((((.(((.((....)).))).)))))..((((.....))))..(((((((........)))))))........(((.......)))......((((((((((.(((....(((((((..((((((..(((.......((((((((.(((((......((((((...........))))))..)))))...........))))))))......((((((.....(((((((..((((((((.((((..((...(((.((((.....)))).))).....((((((......))))))(((((...((((((.(((...)))))))))((..(((((((((.(((((......((.(((((((((((((((((((((.(((((((((((((((((((.....))))))))....................))))))))((.(((((((..(((((((....(((.....)))....)))))))...).)))))).))....((((.(((((((....)))...))))))))))).)))))))))...(((((((((..(((.((((.((((((.((((.(((......))).))))..))))))((.....))((((((((((((....)))))))..)))))..(((((...((..(((...(((((..............................................(((....)))...(((..((((((((((((((((((.((((.((..........((..((((.....................................))))..))..((.....))............)))))).)))))((((.(((((((....(((....)))...)).))).)).))))........(((.(((((((((....)).))).)))))))...)))).)))))))))..))).))))).....)))..)).))))).)))))))..))).))))))(((((..((((((....))))))....)))))..(((((((..((.((((((...((.((((.((......)).)))).)).((((...((((((((...((((.(((((......)))))..)))).)))).))))))))......))))))...))..))))))).....(((((...((((((......((.....))......))))))..))))).........)))))))))))).))))))).((((((((.(((((...))).))...))))))))............((((((......(((..((((((..((((((...(((((...))))).....((((.........))))))))))..))))).)..))))).)))).....)))))))))..))........)))))..))..)))).))).)))))))))))).....((((((((.....(((((((((((((.....(((((.........(((((((.(((((((.....)))..(((((((((.(((((..(((.((.....(((..((((..((((((......))))))..)).((((((((....((.(((((...)))))..(((.....((((......((((...................))))......)))).....)))......((((((..........................))))))...))..)))))))).((((((((.(((..((((.((.((.......)))))))))))..))))))))............))..))).....)).)))))))).)))))))))..(((((((........................))).))))..)))).))))).))..))))).....)))))))))))..(((.(.....)))))).....))))))))))))))...((((...(((((.((((((.((((((((((.((((((.......))))))....(((((...((((........))))....)))))..(((((((......))).))))..(((((((........(((((((((.....(((((.(((.((.(((((......((((......)))).............((((....((((((.....))))))...))))..((((((((((((....(((((((((....(((((..((((((((........))))))))..)))))(((...((((((((......((((((...(((((.((((....((((....))))............(((((...(((.(((((((....(((((.......)))))...............((((...(((((((((((((...((((((..........)))))).((((.....((((....(((((((..((((((.(((....))).)))))).....)))))))......)))).....))))((((((.........(((((...(((.....)))...)))))..((((...))))(((((((((...........(((((.........)))))....((((....))))...((((((.((((.((((..((((.((((........)))))))))))).(((((((((.((.....)).)))))))))....))))...))))))....(((..........))))))))))))...))))))))))))).))))))...)))).))))))).)))))))))))).))))))))))).....))))))))...))).((((((((((...))))))))))..)))))))))....)))))).))))))....(((((((((...((((...))))..))))))))).((((.((((((.....))))))))))))))).)).)))..))))).))))).)))))))))))(((((........)))))).)))).))))).)))))).)))))....))))..)))..)))))).)))))))..))).))))))))))..))))))))))))))..)))..(((.(((((.....((((((...)))))).......))))).))).
Thermodynamic Ensemble Prediction
.((,.((((((((((..(((((((((((((.(......).))))))))))...)))..))))}}))))).,))...{,{.((((({,(({,{.(((({((((.(((,((....}}.))).))))},.((((,...,))))..(((((((........)))))))...,,,..{{{.......)))....,.((((((((((.(((.,..{((((((..((((((..(((.....,,|((((((..(((((......((((((...........))))))..))))).}}},,....,,,||||||{.,...,,,|,|,,...{(((((,..{||||{{{.((((.,((,..{((,((((,....}}}}.))}....,||||||......}))))}{{{{{..{((((((.{((...|}})))))}((..(({((|{{{.,,{{|,|,|,,{{.((((((((((({|{(((((({.{{(((((((((,(((((((.....)))))))|{..........,........))))))))|{.(((((({..(((((((....(({,....})).,..)))))))...}.)))))).}|....((((.((((({{....}},.||)|}})))}},,.}}})}))}}.,,(((((({((..((..{(({.((((((.((((.(((......))).))))..)))))){{....,)}{(((((((((((....)))))))..})})}..{((((,,,((..{(({,.(((({.............,................................(((....)))...(((..{{{(((((((((((((((,((((.((..............(((({,{{{...................,.........,,.)))).,))..,..,.,||}............)))))).))}}){(({.((((({{..,.{{......}},..)),))).|}.|}||......{{{{{.(({,{((((||.,|}.|||{|,,,,)))}}}}}}))))))))))..})).))))),,,,.})}..)).))))).}))))))..)}}.))))))|((((..((((((....))))))..}})}..,.{(((((......))}.)))..,{({{((({((.{{{{(((({..|{||{((((...((((((((...((({.{((((....,,))}}}..))}}.)))).))))}},}))),..}}})))))})))}}||.|||{....,,|||,..{{((({.,{,..{{,|,,,||.|||,,}}},,,..})))},}},,))},)))))))))))).))..}},.((((((((.(((({...})).))...))))))))..........,,(((,{......},}}}.||{{{,..,{{{{,.|,{(({|,,,})))},,..,{{{,.........)))))})))),.}))}}||||||}},,},,))),},))}))))))..}}.....}..)))}}..}}..)))}.))}.}}}))))))}}|....,((((((((..{,..{(((((({{{((,,...{((((,{{...,,.(((((({.,{{{{{{.....}})}|||||{{{{{.(((((,{(((,({..,||{(,,,{({..,{{,{{({,,.{{(||,.|,|}}.{{{{(({{....,,,(((((...})}}}....{..............,{{(({{{,...........,...}}}}.....,||||||...,{{,{....,,{{,.{{...........,}......,|||||,,||,.,}}}..}})))))).((((((((.(({..((((.(,,((.,....}))))))))))}..))))))))...,}}},|...,}}..|||.|.,|},,,,}||||.}}|||||}}..{((((((.............{,........,))).))))}})))}.})))).})}})}))).....)))))))})}}..{{,.,..,..||||,,...),)))))))),}))))},,|,{{...{{{{{.((((((.|{{(((({||.((((((.......))))))....{{{,,...((((........))))....}))))},|{{{{{{......))),})))..(((((({.,.,...|(((({({{{.....(((({.(((,((.((((({..{{,((((......}}}}.,.,..,,..,..||.{,...||||||||,||||,.,...})))))|((((((((((({.,..(((((((((....,((((..((((((((........))))))))..))))|{{{...((((((((......((({{,,{{(((((.(((({{,.,{,,..,}}))|{{{.,({..{{{({{(,..,{,,.|||||,,.}}}|..||}}}},.,|}}}|||{|||.,|||,,|.|{{{,,,{{(((((((((((,,.((((((..........)))))).{{({.,,|,{(((....(((((((..((((((.(((....))).}))))).....)))))))......||}|.{,..}|||{((((({{,{....,,({(({{{({{{{{{{.||.{{|||...,})}))}..)))))}}|{{||..,}},...,.(((((.........))))}.,..((((....))))...{(((((.{(((.,{((..((((.((({.{....,,))))))))||||((((((((((.((.....)).)))))))})))}.}))}...}))))}.,,,|||,,...,,...))}},,}}..,}}},)}}}),)))))))}}))))).,,)}}},}}}})))})))}}}}}}))).))))))))))).....))))))))...))).((((((((((...))))))))))..)))))))))..}.)))))).)))))),...(((((((((...((((...))))..))))))))).|{{|,|||||{....,)}})))))})))))).)).)))..))))),))))).)))))))))))|||||,,,,,...)))))},}))).}}))}.}}}||}.||||}....,,))},))),,)))))).))))))}..))).))))))))))..))))})))))))))..}},..|{{.(((((.....((((((...)))))).......))))).))).

Transcripts

ID Sequence Length GC content
GACUGCGCAGGCGUGCUCACCUGGCGUGCUCCACCCGACUGGGCGUCCG… 3880 nt 0.4572
AGUUGCUUCAGCGUCCCGGUGUGGCUGUGCCGUUGGUCCUGUGCGGUCA… 3228 nt 0.4160
Summary

The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target protein s by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]

Forensic Context

A study in human burn patients demonstrated that the HSP90AA1 mRNA transcript was upregulated at admission in the early mortality group, associating its expression with poorer prognosis [Misganaw et al. DOI:10.1093/jbcr/iraf012]. In a separate human study of post-mortem tissues from sepsis patients, the HSP90AA1 gene was downregulated as part of inhibited protein folding and autophagy pathways in sepsis [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938]. A study in the blow fly *Calliphora vicina* demonstrated that the HSP90AA1 is rapidly up-regulated after cessation of feeding in post-feeding third instar larvae under both diapause and non-diapause conditions, maintaining a high expression level with a slight but steady increase over time, and significant differences in its expression were found between diapause and non-diapause conditions during the first eight days [Fremdt et al. DOI:10.1007/s00414-013-0920-x]. In a rat model of hypothermia, hypothalamic transcriptome analysis identified the HSP90AA1 as being more abundantly expressed in control hypothalami compared to hypothermic ones, with 24 tags versus 9 tags, respectively [Takamiya et al. DOI:10.1016/J.Jflm.2012.04.017].