| ID | Sequence | Length | GC content |
|---|---|---|---|
| GACUGCGCAGGCGUGCUCACCUGGCGUGCUCCACCCGACUGGGCGUCCG… | 3880 nt | 0.4572 | |
| AGUUGCUUCAGCGUCCCGGUGUGGCUGUGCCGUUGGUCCUGUGCGGUCA… | 3228 nt | 0.4160 |
The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target protein s by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
A study in human burn patients demonstrated that the HSP90AA1 mRNA transcript was upregulated at admission in the early mortality group, associating its expression with poorer prognosis [Misganaw et al. DOI:10.1093/jbcr/iraf012]. In a separate human study of post-mortem tissues from sepsis patients, the HSP90AA1 gene was downregulated as part of inhibited protein folding and autophagy pathways in sepsis [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938]. A study in the blow fly *Calliphora vicina* demonstrated that the HSP90AA1 is rapidly up-regulated after cessation of feeding in post-feeding third instar larvae under both diapause and non-diapause conditions, maintaining a high expression level with a slight but steady increase over time, and significant differences in its expression were found between diapause and non-diapause conditions during the first eight days [Fremdt et al. DOI:10.1007/s00414-013-0920-x]. In a rat model of hypothermia, hypothalamic transcriptome analysis identified the HSP90AA1 as being more abundantly expressed in control hypothalami compared to hypothermic ones, with 24 tags versus 9 tags, respectively [Takamiya et al. DOI:10.1016/J.Jflm.2012.04.017].