Basic Information

Symbol
HSPA13
RNA class
mRNA
Alias
Heat Shock Protein Family A (Hsp70) Member 13 STCH Stress-70 Protein Chaperone Microsome-Associated 60 KDa Protein Stress 70 Protein Chaperone, Microsome-Associated, 60kDa Stress 70 Protein Chaperone, Microsome-Associated, 60kD Heat Shock Protein 70kDa Family, Member 13 Heat Shock Protein Family A Member 13 Heat Shock 70 KDa Protein 13 Testis Secretory Sperm-Binding Protein Li 199a Microsomal Stress 70 Protein ATPase Core Microsomal Stress-70 Protein ATPase Core
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Other applications

MANE select

Transcript ID
NM_006948.5
Sequence length
3945.0 nt
GC content
0.3450

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-985.90 kcal/mol
Thermodynamic ensemble
Free energy: -1068.98 kcal/mol
Frequency: 0.0000
Diversity: 893.12
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((.(((((((.(((((((((((((((((((((....(((((....)))))..........)))))((((((((((......)))).)))))).........(((((((...((((.....))))....((((((((((.((..((((((....((((((...(((((((((...)))))))))....(.((((((((........))))...)))).)...((((((((.(((((.......))).)).)))).....))))...((..(((.....)))..)).........))))))...))))))..)).)))))..)))))..))))))).........(((((((((.((((..(((......)))......((((((...(((((.....))))).)))))))))).)))))))))........)).).)))))))))).))))).)))))..((((((.(((((....))))))))))).....((((((..((((((((((.((((((.((((((((((..(((..((((((.(((((((((((..(((((((..(((((((.(((((...)))))...........(((((((((((((.......((((.........))))..(((....)))..(((((.(((...)))..))))).(((((((((.(((((.(((.....))).)))))..))).....))))))......((((((((...((...(((.((((((((((..(((((((.(((((...........((((((.......))))))))))).)))))))..))..............((((((.(((((((((((((..(((((((((((...((((((.(((((((.(((...))).)))))))..((.((((((.((((((((((((((((...(((..((((...(((((.((((((.(.(((.(((..(...........)..)))))).))))))).)))))...((((.....(((((((.(.(((((.(((....))))).)))...).)))))))....))))....))))..)))...)))))))..))))))))).))))))..))....(((((.(((...))).)))))((((((((.((((((((((((((......((((.......))))......))))))).)))((((((.(..((........))..).)))))))))).))))))))...........))))))(((((.((...(..(((..(((((((((((((((((........((..((((((........)).))))..))...((((((..(((...(((((..((((...(((((((...)))))))...))))..))))))))..))))))........((((((((.(((((.......(((.......)))......))))).))))))))...(((((((((...........)))))))))...))))))))...)))))...))))..)))..))).))))).)))))))))))..........((((((.(((((......(.(((.(((((.......))))).)))))))))..)))))).(.((((((((((((......)))........))))))))).).......(((......))).......(((((((((....)))))))))(((((...((.(((((.((((..((((((((((((((..(((((......((((...(((((((.(((.....((((.(((((((((.((((......)))).))))))))).))))))).)))))))...))))..(((((...(((....((((((((..(((...)))....))))))))...)))..)))))......(((((.((((....)))))))))....(((((((.(((...)))..))))))).........................)))))..))))))))).)))))..))))))))).))...)))))))))..))))))))).))))))((((...(((((....)))))..))))...(((....)))........)))))))))))..)).))))).)))..))))).)))))))).....))))))).)))))))......)))))).))))))))))))))..)))))))))))))))).))).)))))))..))))))..((((((.(((((((((....((((((.(((((.(((((((((....(((((((((...((((.((((((.((..((((((((.((.....((((((.......))))))...)).))))))))...))))))))))))(((((....)))))((((((...))))))....((((((((............))))))))(((((((((((((......(((((.((...(.(((((((..(((((((((..((.(((((..(.....((((((((((.........)))))....)))))......)..))))).)).))))))))).))))))).)...((((((((((.(((...)))))))))))))....(((((...(((..(((((((((((((((((((.((((((((...(((...(((...((((((.........((((((((..((.((((....)))).))...))))))))....(((((((((((((((((.((((((............((((((....))))))..((((((.((((((.(((((.((((((((.((......(((.((........((((((((....)))))))).....)).)))...)))))))))).(((.(((((((..((......))..))).))))..)))(((((((((((((...(((((((((((...........)))))))).)))....(((((((((.((((((............(((((((...))))))).....(((((((...............))))))).....................)))))))))))))))...))).)))))))))).....))))).)))))))))))).(((((...((.((((...))))))))))).(((((...)))))...((((....))))..))))))))))))))...(((((((((((((...(((.((((..(((....)))..)))).))).))))...))).)))))))))))))))........(((........))).....(((((((.((((((....)))))).)))))))...))))))......)))....)))..)))))))).))))))))....)))))))))))..))))))))...((((.((((((.....)))))).)))).((((((..(((......)))..)))))))).))))))))))))))))))........((((((((..((((((......))))))..((.(((((.............((((((((....))))))))))))).))....((((((((.((((........(((.(((((....))))))))(((((((..((........))...)))))))...)))).)))))))).))))))))......)))))))))....(((((.....))))).........))).)))))).))))).))))))...(((((((...))))))).(((((((((...)))))))))(((((...(((.((((.....((...(((((...(((.(((((((((..((((........))))....))))))))).))).)))))..)).....)))).))).)))))))))).)))))))))).((((((..........))))))))))))........
Thermodynamic Ensemble Prediction
...((((((.(((((((.(({((((((((((,{,(((((,{,.(((((....)))))...,,.....)))))((((((((((,....,)))).)))))).......{,{((((({...,....,,,.,|}},,.,((((((((((.((..((((((....((((((,,{{((((((((...)))))))),....(.((((((((........))))...)))).)||,|||{((((.(((((.......)))},).))))...,,}|||{|.((..(((.....)))..),..}}},.}})))))}...))))))..)).))))}..}))}}}}}})}))},,,,.,|||(((((((((.(({,..(((,....,)))......((((((..,,{{{,...,.,))}),)}}}}},})).)))))))))....,,,,,}.).)))))))))).))))).)))))..((((((.(((((....))))))))))).....((((((..((((((((((.((((({,((((((((((..(((..((((((.(((((((((((..(((((((..(((((({.,((({...})))|((((({..,{{,.{|||......,...,|{.((((.........)))).}}|,)))})))..(((((.(((...}}},,)))))({{((....,)})))..,|||{{,,||..(((((((((((({.,((({((((({{{.,{,.......,}}},(((.((((((({,{..(((((((.(((((...........((((((.......))))))))))).)))))))..}}......{{{,,...((((((.(((((((((((((,,(((((((((((...((((({.(((((((.{((...))}.)))))))..,{.((((((.((((((((((((((((...(((..((((..,(((((.((((({,(.(({{(((..(...........}..)))))).))))))).))))),}.((((.....(((((({.{.(({{{.(({....}))}}.)))...}.}))))))....)))).,,,||}}..))),..))))))}.,))))))))).))))))..},....(((((.(((...))).)))))((((((((.{({,({((((((({...,{,(({(,......,}}),.,,},)))))))}|)|((((((.,..((........))..,.)))))))))}.))))))))...........}))))){((({.{{...{,.{{{..(((((((((((((((((........,,..((((((........)),,)))..}}...((((((..(((...(((((..((((...(((((((...)))))))...))))..))))))))..))))))...{{{..((((((((.(((((.......(((.......)))......))))).))))))))}}}|((((((((...........))))))))}...))))))))...)))))...))))..,}}...}}.))))}.))))))))))).,........((((((.(((((..,...,,((({,(((,...}}}.))))),),,,}))))..)))))).|.((((((((((((......)))........))))))))).,.......(((,.....}})|,,....{((((((((....))))))))}(((((...((.(((((.((((..((((((((((((((..(((({......,{,,...(((((((.(((,,,,.((({.(((((((((.((((......)))).))))))))).}))}||},||}}}}}.,,)})),.{{{{{,,{{{,..{{(({((({{..((({,{||,,,,,}}}}})))}.})),})))),,}}}}}}|||{{}||||}}|,}}}}))))),},.{((((({.{{(...)))..))))))).......,,,,........,,,}..}))))..))))))))).)))))..))))))))).))...)))))))))..})))))))).)))))){{,|,}}|,{{{....,},}|||}}},...{{{....,,}...,....)))))))))))...}}))}})})))))))),.,)))).})..}}}}))))))).)))))))......))))))}}}))))))))))))..)))))))))))))))).)))},))))))..))))))..(((((,{(((((((((....((((((.(((((.(((((((((....(((((((((...((((.((((((.((..((((((((.{({{,..((((((.......))))))...)),)))))))).,.)))))))))))|(((((....)))))|(((((...))))),...{((((((((.,{,,....,)}))))))))|((((((((((((({....,,{((((,{((({((,,,{,...,|,,,..|}}}}}|{|||}.{,..{((({((({{((({{..,{{{|{{||{,,.,,..||{{....,})))||.||.||}}}})},.,|||}},,||,.((((((((((.(((...))))))))))))}...,(((((...(((..(((((((((((((((((({.((((((((...,{{...,,,...,((({,..(((((..((((......})))..)))))}},..,}||..}||||||,,..{((((((({((((((((,(((({{............((((((....))))))..((((((.((((((.{(({{.{(((((({,{{.....,{,,.{{........((((((((....))))))))..,..||.}}}...)))))))))},(((.(((((((..((......))..))).))))..}))|((((((((((((...(((((((((((...........)))))))).)))....(((((((((.((((((............{(((({(...|}))))|.....{{{{{{{..,............}}})})|{{{.....,,},},,,..,,.)))))))))))))))...)))}}})))))))}.....})))}.)))))))))))).{((((...((,((({...,}}||})))}}.{(((,...})))}...((((....))))..}))))}||)))))}..|{{{{{{(((((({...|||,|{{{,.|||....)))..)})).)}}.}})),,,))).)))})))))))}))).,,,},|||{|||....,.|||{....(((((((.((((((....)))))).)))))))...,)}))),.....,)}...,)),..)))))))).})))))),...})))))))))))..)))))))),,}|,{{.((((((.....)))))).}}))}}}}}}},,,,|,,,,})))),}))..,)))},},)))))))))))))),...,{((,.,,{|||},,((({{(,,,...||||||..,,.|||||....},,,..,}}|(((((({....}))))))}|||||{|{{{{.((((((({.((({.......,(((.(((((....))))))))|((((((..((........}}...))))))}...}})}.}))))))).,))))),}}.}}},))))))))).{({(((((.....))))),}}}.....))).)))))).))))).)))))).,.(((((((...))))))).(((((((({...})))))))),((({...{||.{{{{.....{{...{(({{,,.({(.((((((((({.((((........))))}},.}|||))))}.)))|))))}..,}....,)))),))),)))))))))),}))))))))).((((((..........))))))))))))........

Transcripts

ID Sequence Length GC content
AUCACAAGCCUGUUCGGCGGGACUGUGAUGGCCAGAGAGAUGACGAUCU… 3945 nt 0.3450
Summary

The protein encoded by this gene is a member of the heat shock protein 70 family and is found associated with microsomes. Members of this protein family play a role in the processing of cytosolic and secretory proteins, as well as in the removal of denatured or incorrectly-folded proteins. The encoded protein contains an ATPase domain and has been shown to associate with a ubiquitin-like protein. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that chronic alcohol exposure induces significant molecular alterations in hippocampal tissue, including the dysregulation of numerous miRNAs and mRNAs, with key hub genes FOS and EGR1 being significantly downregulated [Du et al. DOI:10.3389/Fphar.2024.1377501].