Basic Information

Symbol
HSPA1A
RNA class
mRNA
Alias
Heat Shock Protein Family A (Hsp70) Member 1A HSP70-1 HSPA1 Heat Shock Protein Family A Member 1A Heat Shock 70 KDa Protein 1A Heat Shock 70kDa Protein 1A Heat Shock 70 KDa Protein 1 Heat Shock 70kD Protein 1A HSP70.1 HSP72 Epididymis Secretory Sperm Binding Protein DnaK-Type Molecular Chaperone HSP70-1 Epididymis Secretory Protein Li 103 Heat Shock 70 KDa Protein 1A/1B Heat Shock 70 KDa Protein 1/2 Heat Shock 70 KDa Protein 1B Heat Shock 70 KDa Protein 2 Heat Shock-Induced Protein HSP70-1/HSP70-2 HSP70.1/HSP70.2 HEL-S-103 HSP70-1A HSP70-2 HSP70.2 HSP70I HSP70 HSX70
Location (GRCh38)
6:31815543-31817994
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Cause of death analysis Drug abuse diagnoses Time since deposition estimation Sudden unexpected death diagnosis
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_005345.6
Sequence length
2400.0 nt
GC content
0.5979

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-945.20 kcal/mol
Thermodynamic ensemble
Free energy: -985.27 kcal/mol
Frequency: 0.0000
Diversity: 493.84
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........(((((((..((....))(((((((((.(((((((((((((.....)))...((((((....(((((.....(((..((.((((........)))).)))))((((.(((((((((((((....))))((((.....)))).(((........)))((((((((((((......(((.(.((((((..(((((((((((....((((.........)))).((((((.((..((.(((((((((((.(((((......))))))))))))..........)))).))..)))))))).........(((..(((((((.(((((.....(((((((....(((...))).(((((((.((((((.((..((.......(((((.(((((.....(((.((((..(((((...)))))..((((((....))))))..)))).))).((.((((.((((((((....(((((....((((......((((((((.((.((..(....(((...(((.((((((.(((.....(((((((.........))).))))..((.((((((.(.((((((....))))...)).).)))))).))..))).)))))).)))....)))...)..)))).)))))))).....))))..))))).))))).))).)))).)).((((..((((((((((((((((((((.((.....)).)))).))))).....((((((.((((((..(((.((((((.((((((.....(..((((((((((.((((((...)))))).)))))).))))..)..)))).((.(((.((((((......))))..)).))).))......)))))))).)))..))))))(((...))).((((((((.(((.(((..........((((((((..(..(((.(((......(((....)))..))))))..)..)))))))).......(((((((((...)))))).)))..((....))..((((((....)).))))))).)))..)))))))).((((.((((((((((..((((.....))))..))))..)))...(((((.......))))).(((((.(((....(((((.((........)).)))))))).)))))((((.(((....))).))))...))).))))(((.(((.((((.........)))).))).)))..)))))))))))))))))....)))).(((((((......)).)))))......))))).))))).......))..)).)))))).)).))))))))).)))))).)).))))).))..))).((((((((..(((....))).....))).))))))))))).)).))).....)))))))))).....)))))))))))).))))))))).))))(((.(((((......((((..((((.((.(((.(((((.((....((.(((((((.((...(((((((..........)))))))........(((((.(..(..((....((((.(((((..((.........((((((((((((((((.(((.(.(((((.((((.((...)).)))).))))))))).)))))))).)).))))))..((((((...))))))))...))))).)))).))..)..).)))))(((..((((...........................))))))).......)).)))))))..)))).)))))..))))).))))..((((....((.....))..)))).))))...)))))))).((.......(((((.(((((((.((((((((...((.....))...)))))).)).))))))).))))).......))))))))))))))))))))))).)))))...))))....(((((.....((((.....))))......)))))((((((((..((((.(((((((.((((..((((((((((((((.(((...............((((((.(.((.(((.(((...(((((((((((....))).))))))))...))))))..)).).))))))((..((((((((((........)))......)))))))..))........(((....(((((((....)))))))...)))........))).)))))))..)))))))...)))).)))))))(((.(((.((((((.......((((((.......))))))......)))))).)))))).((((((............))))))..))))..))))))))..............)))))))...((((.(((((..(((((....)))))...))))).)))).....
Thermodynamic Ensemble Prediction
...,.,,,(((((((,.((,.,,,,(((((((((.(((((((((({,(.,...))).,.((((((....(((((.,.,,{{{..{{.{{||{{{{,...||||{||{{(((((.(((((((((((((....)))){(((...,.}}}}.{{{......,,))|((((((((((((.,....(((.(.(((((({.(((((((((((...{(.(({(({{....))}|,((((((.({..((.(((((((((((.(((((......))))))))))))},........}))).))..))))))))........,(((..(((((((.(((((.....(((((((....(((...))).(((((((.((((((.((..((.......(((((.(((((.....(((.((((..(((((...)))))..((((((....))))))..)))).))).((.((((.((((((((....(((((....((((......((((((((.((.((..{....(((...(((.((((((.(((....{(((,(((.........))).))))..((.((((((.(.((((((....))))...)).).)))))).))..))).)))))).)))....)))...,..)))).))))))))..,..))))..))))).))))).))).)))).)).{(((..((((((((((((((((((((.((.....)).))))}})))).....((((((.((((((..(((.((((((.{(((((.....{..((((((((({.((((((...)))))).}))))).))))..),,}))).{{.{{(.((((((.,,,..}},},,}),)}},)}.....,)))))))).)))..)))))|((,...))).((((((((.(((.(((..........((((((((..,,.((({{((......(((....))}..),)},)}}),.)))))))).......(((((((((...)))))).)})..,,,,,|||,.((((((....)).))))})),)))..)))))))),{{({.(((((,((((..((((.....))))..)))).,))}...(((((.......))))),(((((.{((,,,.{{{((,((......,,}).}))))}}),))))}((((,(({...,))).))))...}}}.))))|,{.{((.((((......,,.)))).)))})))},)))))))))))))))))....)))},((((({{....,.)).))))).,....))))).))))).......))..)).)))))).))}})))))))).)))))).)).))))).))..))).{((||,,|},(({....))).....))))).)).)))))).)).)))....,))))))))))....,))))))))))))}))))))))).)))}|,{,(((((..((..((((..((((.((.(((.(((((.((...,((.(((((((.((...,{(((((..........)))))||,{.,,,,.(((((.{..{..({....((((.(((((..{(.........{(((((((((((((((.(((.(.(((((.((((.((...)).)))).))))))))).)))))))).))},))))}..((((((...)))))),,...))))).)))).)}..}..}.)))))(((..((({.....|,,,.....,...........,))))})),..},..)).)))))))..)))).)))))..))))).))))..((((...,({...,.)}..)))).)))),..},))))))))))......(((((.(((((((.((((((((...{|,,,.,}}.|.}}}})).}}.))))))).)))))..,.,}.),))))))))))})))))))))).)))))...)))).,}.||||,.}}}}{|||},,..)|||......|||||((((((((..((((.{((((((.,{(({{((((((((((((((,({{......,,.,,.,..((((((.{.((.{((.{((...(((((((((((....)))}}))))))),..))))))..}).}.))))}}((..((((((((((........)))......))))))).,)),{{{,.,,.,,....{{{{{||,...}))))))..,}},...,...,},..,))))),.,)))))))...,)))}))))))|((,,(((.((((({....{{.((((((.......))))))......)))))).))))))}((((((............))))))..))))..))))))))...........,..}}}}))),,.,(({.(((((..(((((....)))))...))))).)))}.....

Transcripts

ID Sequence Length GC content
NM_005345.6 NCBI
AACGGCUAGCCUGAGGAGCUGCUGCGACAGUCCACUACCUUUUUCGAGA… 2400 nt 0.5979
Summary

This intronless gene encodes a 70kDa heat shock protein which is a member of the heat shock protein 70 family. In conjuction with other heat shock protein s, this protein stabilizes existing protein s against aggregation and mediates the folding of newly translated protein s in the cytosol and in organelles. It is also involved in the ubiquitin-proteasome pathway through interaction with the AU-rich element RNA-binding protein 1. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which encode similar protein s. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the HSPA1A was significantly up-regulated in liver tissue during severe heatstroke compared to fever, and its differential expression was validated by RT-qPCR and Western blot, indicating its potential as a forensic marker for distinguishing hyperthermia-related deaths [Duan et al. DOI:10.1007/s00414-025-03634-8]. In human postmortem brain studies, elevated HSPA1A mRNA was significantly increased in cocaine-related fatalities compared to drug-free controls and was predictive of a documented period of survival and medical or police intervention after drug use, irrespective of excited delirium [Johnson et al. DOI:10.1111/J.1556-4029.2012.02212.X]. A study in humans demonstrated that the HSPA1A exhibits statistically significant rhythmic expression in blood, with peak expression in the afternoon (15:30-17:00 h), and was identified as one of three final mRNA predictors for estimating blood deposition time into three day/night categories [Lech et al. DOI:10.1016/J.Fsigen.2015.12.008]. Another human study using cultured fibroblasts from SIDS cases and controls found that the HSPA1A expression was significantly higher and more prolonged in response to thermal stress in the SIDS group, and its up-regulation was lower in SIDS infants found in the prone sleeping position [Rohde et al. DOI:10.1016/J.Forsciint.2013.06.003].