| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUGGUCUCCAUGGCGAUGCUGACCGCCUGCGCUUCAGCGCCUAAUUGA… | 2762 nt | 0.5076 |
This gene encodes a 70kDa heat shock protein. In conjunction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which also encode isoforms of the 70kDa heat shock protein. [provided by RefSeq, Jul 2008]
A study in weanling swine demonstrated that cutaneous bromine vapor exposure significantly increased the HSPA1L transcript at all post-exposure time points (6h, 48h, 7 days) for both 7- and 17-minute exposures, with fold changes ranging from 2.097 to 2.556 [Price et al. DOI:10.3109/15569527.2010.546003]. In humans, a genetic association study identified a 5-bp indel polymorphism (rs3036297) in the related HSPA1B gene as significantly associated with susceptibility to sudden cardiac death, where the insertion allele conferred a lower risk (OR=0.58), and functional assays showed this variant regulates gene expression via miR-134-5p binding and long-range interactions with HLA-DRB5 [Yang et al. DOI:10.1016/J.Forsciint.2020.110637]. A study in humans demonstrated that the HSPA1L exhibits statistically significant rhythmic expression in blood, with peak expression in the afternoon (15:30-17:00 h), and was identified as one of three final mRNA predictors for estimating blood deposition time [Lech et al. DOI:10.1016/J.Fsigen.2015.12.008].