Basic Information

Symbol
HSPA1L
RNA class
mRNA
Alias
Heat Shock Protein Family A (Hsp70) Member 1 Like HSP70-HOM Hum70t Heat Shock Protein Family A Member 1L Heat Shock 70 KDa Protein 1-Like Heat Shock 70kDa Protein 1-Like Heat Shock 70 KDa Protein 1-Hom Heat Shock 70kD Protein-Like 1 Heat Shock 70 KDa Protein 1L Epididymis Secretory Sperm Binding Protein Heat Shock 10kDa Protein 1-Like HSP70-Hom HSP70-1L HSP70T
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Time since deposition estimation

MANE select

Transcript ID
NM_005527.4
Sequence length
2762.0 nt
GC content
0.5076

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-956.20 kcal/mol
Thermodynamic ensemble
Free energy: -1004.64 kcal/mol
Frequency: 0.0000
Diversity: 666.00
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((..(((....)))..)))))..((((.((((..((((((.((((((((((.(((.((((.((((((.((((((((.((((((...)))))).)))))))).))))((((((((((.((((((((.(((((......(((.((((..(((((((((((..(((....))).))))).............(((((((.((((.((((.((....)).(((((((((..........)))))))))..(((((((.............)))))))(((((((((((((((..(((((((.((........)))))).)))..))))))))...((.((((((((..((..(((.(((((((((........).))).))))).))).))..)))))))).)).((.((((....)))).)).....(((...))).(((..(((((((((.(((((......))))))))).)))))..)))...(((((((.....(((.......(((((((..(((((..(((((((((..((((((((..(((.(((((.(.((((((((((((((((.(((........))).))).....)))))).......((((........))))(((((..((((((((..........))))))))......))))).....(((((((((((((((.........)))).))))).....)))))).((((((((((....((((.((((.......)))).))))(((((....))))).((((((.(.(((..(((...((.(((......(((((....))))).....))).)))))..))).).))))))...(((((........(((.......))))))))....)))))))))).((((((..(((((.....)).)))..))))))..)))))))).))).)))))((((((.(((((((((((((...((((((((.(((.(......).))))))))))).)))))......(((((((...)))))))......)))))))).)))))).............))))))))...((((....)))).((((.(((...(..((((.........(((.(((((..(((....)))..))))).))).........))))..).))).)))).....(((((((((...)))))).))).......((((.((((((....)).)))).))))(((((.((((((......(((((.(((((.(.(((....)))).))))).)))))...(((((((..((.(((((........))))).))......(((....)))((((.((((((((((........)).)))))))).))))..)))))))...((((((((..........))))))))(((((((((...(((((.(((((..((((.((((((.(.(((((.(((......)))...(((((((.....))).))))..))))).).)))))).)))).))))).))))).....).)))).))))(((((((((((.((((.((..(((((((...))).)))).)))))).))..))))))))))))))))))))....))))))))).))).))..))))))).....)))...)))))))..)))))))...)))).))))))))))))))))).))))))).........((((((.((((...(((((((((((((......))).......(((.......)))(((((((.(((((.(......).))))).)))))))..((((((((((..((.((((..(((((((.(((((((((((((((...))))...)))))))))((((((((((...((((....(((.(((((......))))).((((.(((..(((...((.(((.....))).))...))).(((((...(((((((((((...........)))..........)))))))).........))).))......((((((..((.(((..((((.((((((.....)))))).)))).....))).))..))))))..))).))))((((((((.........))))))))...))).....))))..)))))))))))).)))......((((..(((((.(((((((((((.....(((((..(((((.((((.(.(((((.........((((......((((.....))))))))..((((((((((((........))))).).))))))..((((((...))))))........((((((.........))))))........((.(((((....))))).))))))).).)))))))))..)).))))))))).)))))....)))))..))))))))..)))).))..))..))))))))..(((((......)))))))))))))))....))))))))))......(((((..(((...........)))..)))))......))))))))).....))))..(((((......)))))........)))))).))))............)).)))).))).))).)))))))(((((........(((.....)))........)))))..))))))..))))))))(((((.....((..(((((((((((((((....)))))))((((....)))).))))))))..)).......)))))........
Thermodynamic Ensemble Prediction
..,((((..(((....)))..))))|{{(((({{{{{,,(((({({((((((((((.(((.((((.((((((.((((((((.(((((,...}))))).)))))))).))))((((((((((.{{((({{({(((({.,,|{,({|{{((({,(((((((((((..(((,...})),))))){,{{.|,,.....,((((((.,,||}||||.,,..,,))}||(((((,,....,,.,,.|||||||}|..(((({((......,,,,,,,|||}}||(((((((((((((((..(((((({,((........)))))).)))..)))))))),..((.((((((((..((..(((.(((((((((........).))))))))).))).))..)))))))).)).((.((((....)))).)).....(((...))).,((..(((((((((.(((((......)))))))))}}))))..))}...(((((((.,...(((.......(((((((..{{(({,.{((((((({..((((((((,,({(.{{{{(,(.((((((((((((((((.(((........))).))).....)))))}...,...((({,...,,..,,,}{{{((..((((((((..........))))))))..,,,,))}},..,..|{{{{{(((((((({.........)))))))))},,,,|||||||{((((({((((....((((.{(((.......)))}.))))(((({....})))),((((({.{.{||..{|||..||.{{(......(((((....))))).....|}}.||}}},,|||,}.}}}}}}...{((((....,..,(({..,,,..}||}}}}}....}})}}}||}},((((((..((({(.....)}.)}}..}))))}}}}))))))).))),)))}}((((({.(((((((((((({...(((((((,{(((.(......).))))))))))).))))},,.,|,(((((((...}))))))...}}})))))))),))}))),,...,,,,,},.,))))))),))}})}),,,|{{,,,,|||||||||||}||||}......|||||,||}))).||||,|||}}}.{|||..,.,,.....,.....},.}.}}..)}.},,,..(({((((((..,}})))).)}}.))))},{(((.((((((....)).)))).)))|(((((.((((((......(((((.{((({.{.{{{...,}}},.})))}.)))))...(((((((.,((.(((((........))))).)).,....(((....)))((((.((((((((((........)).)))))))).))))..)))))))...((((((({.,,......,))))))))((((((((,...(((((.(((((..((((.((((((.{.(((((.,..,......})..,(((((((.....))).)))}..))))).}.)))))).)))).))))).))))).....).)))).))))((((((((((,.((((.,{..(((((((...}}},))}),)))))).,},.))))))))))))))))))))}.,,))))))})),})).})..))))))).....)))...))))))).,)))))))..,}|}},}}})})}}))}))}))).))))),,...,.....((((((.((((...(((((((((((((......))).......{((.......))|(((((((.(({({.,,,....,,)))})})))))))..((((((((((..((.((((..(((((((.({(((((((((((((...))))...)))))))))((((((((((...((((..,,(({.(((((......)))))..,{({,.{,.(((...((.(((.....))).))...))).,,,||}}}|(((((((,((.,.........,,,......,.,,)))))))|,,,,....,||}|||......((((((.,((.(((,(((((.((((((.....)))))).)))).,,..})),))..))))))...,,.|,..((((((((.........))))))))...})),..,.)))).,))))))))))}).)))......((((..(((((.(((((((((((.....,(((,..(((({{((((.{.(((((,........,,,|......{(((.....))}),|||,.((((((((((((......}}))))}.}.)))))}..((((((...))))))........{{{(((,.,......}}))}}..,,....{{.(((((....))))).))})))),).))))))))).})).),,)))))).))))).,,.)))))..))))))))..)))).))..))..))))))))..(((((......)))))))))))))))....))))))))))},....{{({(,.(({|,....,,..,})).,))))}...,,.)))))}}}}.....}}))}}||||,.,,,,.,}}))}}}.....)))))).))))............)).)))).))).))).)))))))||{((..,.,,,.(((.....}))...,.,,.}}}}}..})))))..)))}}}}}(((,,.,}}||,{{,((((({{(((((((....))))))),,||}}}}),)).}},},}}}..,,..,,},,,.})),}......

Transcripts

ID Sequence Length GC content
GUUGGUCUCCAUGGCGAUGCUGACCGCCUGCGCUUCAGCGCCUAAUUGA… 2762 nt 0.5076
Summary

This gene encodes a 70kDa heat shock protein. In conjunction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which also encode isoforms of the 70kDa heat shock protein. [provided by RefSeq, Jul 2008]

Forensic Context

A study in weanling swine demonstrated that cutaneous bromine vapor exposure significantly increased the HSPA1L transcript at all post-exposure time points (6h, 48h, 7 days) for both 7- and 17-minute exposures, with fold changes ranging from 2.097 to 2.556 [Price et al. DOI:10.3109/15569527.2010.546003]. In humans, a genetic association study identified a 5-bp indel polymorphism (rs3036297) in the related HSPA1B gene as significantly associated with susceptibility to sudden cardiac death, where the insertion allele conferred a lower risk (OR=0.58), and functional assays showed this variant regulates gene expression via miR-134-5p binding and long-range interactions with HLA-DRB5 [Yang et al. DOI:10.1016/J.Forsciint.2020.110637]. A study in humans demonstrated that the HSPA1L exhibits statistically significant rhythmic expression in blood, with peak expression in the afternoon (15:30-17:00 h), and was identified as one of three final mRNA predictors for estimating blood deposition time [Lech et al. DOI:10.1016/J.Fsigen.2015.12.008].