Basic Information

Symbol
HSPA5
RNA class
mRNA
Alias
Heat Shock Protein Family A (Hsp70) Member 5 BiP GRP78 Heat Shock 70kDa Protein 5 (Glucose-Regulated Protein, 78kDa) Immunoglobulin Heavy Chain-Binding Protein Heat Shock Protein 70 Family Protein 5 Heat Shock Protein Family A Member 5 Endoplasmic Reticulum Chaperone BiP Glucose-Regulated Protein, 78kDa 78 KDa Glucose-Regulated Protein Binding-Immunoglobulin Protein HSP70 Family Protein 5 Heat Shock 70kD Protein 5 (Glucose-Regulated Protein, 78kD) Endoplasmic Reticulum Lumenal Ca(2+)-Binding Protein Grp78 Epididymis Secretory Sperm Binding Protein Li 89n EC 3.6.4.10 HEL-S-89n GRP-78
Location (GRCh38)
9:125234853-125241382
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Mechanical injury analysis Cause of death analysis
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_005347.5
Sequence length
3921.0 nt
GC content
0.4614

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1228.60 kcal/mol
Thermodynamic ensemble
Free energy: -1308.56 kcal/mol
Frequency: 0.0000
Diversity: 876.57
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((........(((((.......(((((((..(.((((((((.(..........).)))))))).)((((((((((((((............((((((...((((((((.........(((((.((.(((((..((((........))))(((((((......)).)))))..))))).))...))))).(((((((.....))).)))).........(((((.(((((((((((((.((((.(((((.....)))))))))..((((((..((((...(((((..((((((((.((((((((((....)))))((((.....))))((((.(((.((((.((((....)))))))))))))))...((((....))))..((....)).......))))))))))))).)))))..))))(((((((.(((((.((..((...(((((((........((((((((((((..((..((((..((((..(((.(((....))))))..))))((((((((......)))..))))).((((((........)))))).))))..))(((((.............)))))................))))))))))))...((((....))))(((((........(((.(((((((((((..(......)..)).))))((((((((((..(((((((((.(((((.....((((((....))))))..))))).)))).......))))).((((.(((((((.......))).....))))))))......(((((((...)))).))))))))).))))(((.......))).)))))..))).....))))).((((........))))(((.....)))..)))))))...)).))))))).))))))).(((((((...)))))))))))))..)))))))))))))..)))))...((((((((((((((((..((((((((((((.(((((((((((.(((((((..((........))..(((((((.....((((......))))...(((((.(.((((......(((.((((..((....((((.....))))..((((((((((..((((.......))))..)))).((((((...))))))))))))............))..)))).)))...)))).).)))))....((((((......)))))).......)))))))......((((((((...(((......)))....)))))))))))))))..)))))).....))))).))....(((((.....))))).....))))))))))..)))))).(((.((.((.......)).)).)))..)))))))))).((....))....))))))))...))))))(((((.(((.((((((.(((((..(((((.(..((((((.((.((((...((((.(.(((..(((..(((......))))))..))).).)))).((((.(((((((...(((..((((((((........((((((...(((.....)))...))))))........))).))))).........(((((...........))))).((......))(((.(((((((..((((((.(((((((((..(((.(((((.............))))).)))))))))))))).))))..))))).)))))(((((((((((((((.(((.(((.(((.......(((.((.((......................))..)))))....))).))).))).)))))).(((.....))).(((((((.(((((((...((((((.....)).))))...)))....)))))))))))..........((((....))))))))).)))))))...))))))).))))..............(.(((((........))))).)...)))).)))))).))....).)))))..........))).)).)))))).))))))))(((((((((.((((....((((........))))...((((...........))))...))))..))))))...))).))))))))))))))((((((((.((((((((((...(((((((.....((((.(((.......))).)))).....)))))))...((.(((.(((((((((.(((..((((((............))))))..))).)))).))...))).))).)))))))))).(((((((((((...((((((((......((((((.......)))))).....)))))))))))).))...))))))))))))))).((((..((((..((((((((((....(((((.....)))))..)))))))).))))))..))))....((((......))))..))))))))))))..)))))))..(((((((..((((((((((((((((.((.....))..)))))))))...)))).((((((((((((..(((((((...((((...............((((......(((((((((((....))))((((((((((((((((((..(((((..((((((((..((((....))))...........((((((((((((((((((((((((...(((((((((..(.((((((.((((..(((((((((....................(((((((.((.(((((((((((((...(((.......((((.((((((((((((((((((((((.((((............(((((((....))))))))))))))))((((....))))....))))))))...))))))))).))))........)))..(((.(((((((.........((((((...))))))........))))))).))).....((((((((((((((((((((....)))))(((....)))..(((((.((((..(((((.((((.(((((.....))))).))))..)))))..)))).)))))......)))))))......))))))))(((((((...(((((((((((.((((.((((.........))))..))))))))).((((((((..((((((......((((.((((((((.(.....(((((((((((.(((.......))).))))))).........)))).....((((...)))).....).)))))))).)))).......))))))...((((.((((...(.((((((....)))))).)...)))).))))(((.((((...........)))).)))..)))))))).))))))...))))))).............))))))))))))).)))))))))..)))))))))..)))).)))))).)..)))))))))..((((((((((((..............))))))).....(((.(((......))).))).....((((...)))).))))))))))))))))))))))))).....((((((...((((.....))))...))))))(((((((...(((.....)))....)))))))....))))))))))))))))))))))..(((((.(((((..((.((((((.(((((((((.....)))))))))..(((((((((....)))..)))))).........(((((((.(((..((.....))..))))))))))((((((......))))))......))))))))...))))).))))))))))))))))))...((.((.(((....)))))))..))))))).....))))))))))))))).)))).))))))))...))).)))))))..
Thermodynamic Ensemble Prediction
.(((((((....,...(((((.......(((((((..(.((((((((.(..........).)))))))).)(((((((((((((({{..,{(,,,,,{|,((((((.(((((,,,,({{,((((({(,{,.(((((((.((((........))))(((((((((.({{.({.({{({,{{|||.}....|||.{{{({{{{{.....))).)))}.......,|{(({({(.,{({(({((.{(({((.({{....)))))))))))))))),)),)))),,,,.,.,}|,),})).))))})))})),)|}}}..}.))||||}..,,),,.((((.(((.((((.({{,....,))))))))))))))...((((,,..}}}|||||||....{{{{,..||||||..(((((.((((({....)))))).)},))),,))}})))))))}})))).))))))((((((((((((..,{..{{{{.,(((({{(,({(,,..{{||||,,..)))))|,|}},|}}.}}})}},,||,||.(((((({.....}})))))).)),)..}|{((((.............}}))},....,,...,}}...})))))))))))...,,,{....}}}}|,..{{{(,,,,{{|||.{{,{((((((..{......)..})}}})),(((((((((.(((((......((((((((..((((((....))))))...,,..,,,.....|,,}......(((,,(((((((.......))).....)))))))).....{{{,{{...((((((((((.(((((((((((((.((((({(({,((((({(.....,,.{(,.((((((((...(((((..(({,(((,.((.....))},)))))}..))))).))))))))}.)),|,...,.,|(((((((({.{{{,{....})))..))))))))){(((((((((((((((..((((((((((((.(((((((((((.(((((((..{{........,,..(((((((.....((((......))))...(((((.{.((((......(((.((((.,((....((((.....))))..((((((((({..((((.......))))..})))}{(((((...))))))}}}}}}.,,,},,,,,,.)),.)))).)))...)))).}.)))))....(((({(......))))),.......)))))))......{(((((((...(((,.....}}),,,.)))))))))))))))..)))))).....))))).)).,,.(((((.....))))),}...))))))))))..)))))).(((.((.((,....,,)}.)).)))..)))))))))).))))))))).)))))))))))))..))))).)),....,..))))))))...}})}}))))))))(((((((({,{.(((,..,,,...}}||.(((((..(((.(((......))).)))..)))))..||.,,{...,)))))})))))))))..)))))))))))))){(((((((((((((((,{,,...,}..((((((.{{,(,.((,..(((({(((((((((..,{{((..({....{((......})})}.)))}.,.(((((((((..{((,,,,{(,{{.{,.....},))))),)}}))))))))).)))))))).,,))}))),)}}.}},,.{((((((.(((.(((.{({.......(((.{,{({,..................,,.))..}})))....))).))).))).))))))}{((.....))).(((((((.(((((((...((((((.....)).))))...))),...}))))))))))..........))))))..((((........(((((((.........)))))))....,...)))){(((((....)))))|||{........}}}}.....,,...}))))))))))},,}}))},...(((((....))))).,,,,,{({{,,.||{{....((((........}}})..,|,,,}|}.,}}},,,,))),..}},,..}}))))...))}.})))))))))))))((((((({.{,((((((((...(((((((.....((((.(((.,....,))).)))).....)))))))...,,.,,,.,{{.(((((.(((..((((({.,........,.})))))..))).))))}|,,..,,,.))}.}.)))))))).(((((((((((...((((((((......((((((.......)))))).....)))))))))))).))...))))))})))))))).((((..((((..((((((((((....(((((.....)))))..)))))))).))))))..))))....((({......})))..)))))))))))).,)))))))..(((((((..((((((((((((((((.,{.....,}..)))))))))...)))).((((((((((((..{((((((..,{{{,....,,.,,.....{{{{{{.,{..(((((((((((....))))((((((((((((((((((..(((({.,((((((({.,(((,....)))}..........,((((((((((((((((((((((((...(((((((((..(.((((((.((((..(((((((((..{{,.....,|.,......{((((({,((.((((((((((((({{((,{,,..,,,((((.(((((((((,{((..{{{(({{.{(((..,,........(((((({....}))))))}})))))))||||.},,||||.....}}}}},.,..})))))))).})}}...,,{,,|(((.....||||||{.,,,.....((((({...}})))){{{.....)))||||||||||,..((((((((,,{(((((((((....})))|{{.....,|,.,(((((,((((..(((((.(((,.(((((.....))))).})))..)))))..)))).))))).},...))))}))}}}...)))))))}(((((((...{((((((((((.{{({.((((.........))))..)}},))))),{{{{((((..{{{(((,||...{{{{.{((((({{.{,...,||,,(((((((.(((.......))).)))))))....,,}}}|||},,,..}||,.,,,}|......},}}}}}}},.})))..,....,}}}},...{(((.((((...(.((((((....)))))).)...)))).)))){{{,,{((({{.{,,,,}}}}}}}}}}..)))))))).)))))).,,)))))))..,..},,,....))))))))))))).)))))))))}.)))))))))..)))).)))))).)..)))))))))..(((({{((((((.............,))))))},,|..(((.(((......))).))).....({({,..,,,,.))))))))))))))))))))))))).....((((((...((((,...,))))...))))))(((((((...{((.....,))....)))))))....))))))))))))))))))))))..{{{{{.{((((.{{{.((((((,((((({{{,.....,}|||||}}..(((((((((....)))..))))))....}}}},(((((({{(((..((.....))..))))))))))((((((......)))))).....,)))))},)}..))))).))))))))))))))))))...((.((.(((....)))))))..)))))))..}}.,,}}))))))))))).)))).))))))))...))).)))))))..

Transcripts

ID Sequence Length GC content
NM_005347.5 NCBI
GACGCCGGCCAAGACAGCACAGACAGAUUGACCUAUUGGGGUGUUUCGC… 3921 nt 0.4614
Summary

The protein encoded by this gene is a member of the heat shock protein 70 (HSP70) family. This protein localizes to the lumen of the endoplasmic reticulum (ER) where it operates as a typical HSP70 chaperone involved in the folding and assembly of proteins in the ER and is a master regulator of ER homeostasis. During cellular stress, as during viral infection or tumorogenesis, this protein interacts with the transmembrane stress sensor proteins PERK (protein kinase R-like endoplasmic reticulum kinase), IRE1 (inositol-requiring kinase 1), and ATF6 (activating transcription factor 6) where it acts as a repressor of the unfolded protein response (UPR) and also plays a role in cellular apoptosis and senescence. Elevated expression and atypical translocation of this protein to the cell surface has been reported in viral infections and some types of cancer cells. At the cell surface this protein may facilitate viral attachment and entry to host cells. This gene is a therapeutic target for the treatment of coronavirus diseases and chemoresistant cancers. [provided by RefSeq, Jul 2020] CIViC Summary for HSPA5 Gene

Forensic Context

A meta-analysis in humans identified a network of 33 validated interacting proteins linking post-mild traumatic brain injury (mTBI) signaling in peripheral fluids with neurodegeneration-associated pathways, where the HSPA5 was characterized as a key hub protein that is up-regulated post-TBI and is neuroprotective [Matyasova et al. DOI:10.4149/gpb_2021038]. A study in rats demonstrated that the HSPA5 was highly expressed in the cortex and midbrain following fatal ligature strangulation, indicating endoplasmic reticulum stress involvement in this form of mechanical asphyxia [Feng et al. DOI:10.1097/PAF.0000000000000298].