Basic Information

Symbol
HSPB1
RNA class
mRNA
Alias
Heat Shock Protein Family B (Small) Member 1 HSP27 HSP28 Hs.76067 Hsp25 CMT2F Heat Shock Protein Family B Member 1 Estrogen-Regulated 24 KDa Protein Stress-Responsive Protein 27 Heat Shock 27kDa Protein 1 Heat Shock 27kD Protein 1 Heat Shock Protein Beta-1 28 KDa Heat Shock Protein Heat Shock 27 KDa Protein SRP27 Epididymis Secretory Protein Li 102 HEL-S-102 HSP 27 HMN2B HMND3 HspB1
Location (GRCh38)
7:76302673-76305813
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Sudden cardiac death diagnosis Cause of death analysis Forensic psychiatry evaluation
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_001540.5
Sequence length
777.0 nt
GC content
0.6525

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-288.20 kcal/mol
Thermodynamic ensemble
Free energy: -302.57 kcal/mol
Frequency: 0.0000
Diversity: 293.58
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((..((((.........((((((((((((.......)))).(((((..............)))))..((((((..((((((((((....))))).).)))).....(((((((((((.((.((((((..(((((((((((...))))..)))))))..)))))).)).)))..(((((((((((.(((((.(((((.(.((((((((.((..(((((.((..(((((((((((((.((((.((....)).)))).((((.((.....)))))).........)))))).)))((.((((((....((((((....((((((((.(((((..((.((..........))))..))))).))(.(((((((......(((((((.((((.((....((((((...(((...((((((.(.((..(((.(((....))))))))).))))))..(((........))))))...))))))....)))))))))....))))...((((........)))).....))))))).).(((......)))...))))))..))))))....)).)))).)).............)))))).)))))....))..))))))......((.(((...((....))...))).))........))).))))).))....)))...)))))))))))...))))))))...)))))).....(((((((.....)))))))......)))))))).))))...))))).....)).......
Thermodynamic Ensemble Prediction
{,{((({..((((,,{,.|,.,{({(({({((((,,,,,..}}}}.(((((..{.{.........})))).((((((...(((({{((((.....))),,).))))..))))))(((((((,.,,.((((((..((((((((({(,..,})).,)))))))..)))))).})})))}}((((((.((((..(((({,(,..}.}},)))..)))).....)))}}},{((((({{,(((({(((((.((((..((.....}}.)}))||.,{||||{|......||,|||||||,,,||.,{{{|||,...{{{|||...|{((((({{{{((.,{((((......,{(((((((((...{((((((..((((..((({{(((.((((,.(((((.((((.,{(({..((..,.{{.||{||.(({{,.((,((({{,,,,||,|{((|{||||.|((({.....,,|||{||....}|||||{{.{,||||...,{{.,,||,.,{..,{,,,,..,}))).},},},,,})))),)}|..},,,}}}...}})})))},}}.}}}}..,}.)))).))),}...)))))))).).)))...))))})))))))))))...)))).,}....})))}..)}})),)}}))),.)}...})).))),))))})..))},}})))))))})},.))))))),)}.......)))),,)|||.|{{}}}|||}}|,.,...,..}}})}}},.)}}}...))))).}...}........

Transcripts

ID Sequence Length GC content
NM_001540.5 NCBI
GCACUUUUCUGAGCAGACGUCCAGAGCAGAGUCAGCCAGCAUGACCGAG… 777 nt 0.6525
Summary

This gene encodes a member of the small heat shock protein (HSP20) family of protein s. In response to environmental stress, the encoded protein translocates from the cytoplasm to the nucleus and functions as a molecular chaperone that promotes the correct folding of other protein s. This protein plays an important role in the differentiation of a wide variety of cell types. Expression of this gene is correlated with poor clinical outcome in multiple human cancers, and the encoded protein may promote cancer cell proliferation and metastasis, while protecting cancer cells from apoptosis. Mutations in this gene have been identified in human patients with Charcot-Marie-Tooth disease and distal hereditary motor neuropathy. [provided by RefSeq, Aug 2017] CIViC Summary for HSPB1 Gene

Forensic Context

A study in humans demonstrated that the HSPB1 was identified as a top diagnostic gene, showing a higher trend in post-myocardial infarction heart failure patients compared to non-heart failure patients in PCR validation [Sun et al. DOI:10.3389/fimmu.2023.1163350]. In a separate human postmortem brain study, the HSPB1 was identified as a seed gene in a protein-protein interaction network cluster associated with depressed suicide, with its module's genes significantly enriched in endothelial and microglia cell types [Zeng et al. DOI:10.1016/j.psychres.2020.113513]. A study in human neonates demonstrated that the HSPB1 is upregulated at birth in those who later develop early-onset sepsis, serving as a predictive biomarker and a top discriminator identified by sparse partial least-squares discriminant analysis, and it is part of the enriched "Regulation of HSF1-mediated heat shock response" pathway [An et al. DOI:10.1016/j.ebiom.2024.105411]. In a rat model of acute right heart failure, the HSPB1 was found to be enriched in multiple pathways including nucleotide oligomerization domain-like receptor signaling, NF-kB signaling, cytokine-cytokine receptor interaction, and chemokine signaling in the left ventricle following pulmonary artery banding [Cao et al. DOI:10.1177/2045894019879396].