| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAGAAGUUUCUAGGCGCGCGUGCCCUGGGUUUAUUAAGCUCCUGGCU… | 1861 nt | 0.5218 |
The protein encoded by this gene belongs to the superfamily of small heat-shock proteins containing a conservative alpha-crystallin domain at the C-terminal part of the molecule. The expression of this gene in induced by estrogen in estrogen receptor-positive breast cancer cells, and this protein also functions as a chaperone in association with Bag3, a stimulator of macroautophagy. Thus, this gene appears to be involved in regulation of cell proliferation, apoptosis, and carcinogenesis, and mutations in this gene have been associated with different neuromuscular diseases, including Charcot-Marie-Tooth disease. [provided by RefSeq, Jul 2008]
A study in porcine skin demonstrated that the HSPB8 was significantly decreased in all four bromine exposure groups (45 s and 8 min at 24 h and 7 d) [Price et al. DOI:10.1016/j.toxlet.2008.08.007]. In a separate investigation of sulfur mustard and thermal burn injuries in porcine skin at 7 days postexposure, the HSPB8 was also found to be significantly decreased in response to both HD and thermal exposure [Price et al. DOI:10.080/15569520903097754]. A study in humans demonstrated that the HSPB8 was downregulated during long-term weight loss (0 to 12 months) in weight losers within subcutaneous adipose tissue [Bollepalli et al. DOI:10.1038/ijo.2017.245].