Basic Information

Symbol
HSPB8
RNA class
mRNA
Alias
Heat Shock Protein Family B (Small) Member 8 E2IG1 HSP22 CMT2L H11 Small Stress Protein-Like Protein HSP22 Heat Shock Protein Family B Member 8 Heat Shock 27kDa Protein 8 Heat Shock 22kDa Protein 8 Heat Shock Protein Beta-8 E2-Induced Gene 1 Protein Alpha-Crystallin C Chain Protein Kinase H11 HSPB8-N1 HSPB8-N2 DHMN2 HMN2A HMND2 MFM13 CRYAC HspB8 HMN2
Location (GRCh38)
Forensic tag(s)
Wound age identification Mechanical injury analysis Cause of death analysis

MANE select

Transcript ID
NM_014365.3
Sequence length
1861.0 nt
GC content
0.5218

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-668.80 kcal/mol
Thermodynamic ensemble
Free energy: -702.66 kcal/mol
Frequency: 0.0000
Diversity: 581.08
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((..((((((((.((((((((.(((((((((((((((..(((.((((((.(....((((.....))))..(((((((......))))))).((((((..((((.((.(((((((...(((..(((((....)))))..))).(((((...)))))((((((....))))))(((((((((..((((...(((((..(((((((((((((.((((((......))))))((..((((((((((((((........))))))..(((((.(((((((...)))))))....))).)))))))))).))..(..(((((.((.....(((((((.(((((.........)))))))))......(((((.(((..((((((...)))))).))))))))........((((((((......((((((((.(((.(((((........((((...))))......)))))..))).))....))))))))))).)))))).....)).)))))..)...(((....))).)))))))).........))))).)))))(((((((((((...)))..))))))))..)))))))))))))......)))))))))......(((((.((((((...)))))))))))))))..)))))).).))))))..)))((((.(((((......)))))))))..(((((..(((((((.((((....))))..(((((....(.((((((.((((.....)).)).........(((.((((.(((.....(((((.............)))))..))).)))).))).(((((((((.(((...))).))))))))).....(((((((((((((((((..(((((((((((....(.((.((((.............)))).)).).(((.....))))))))))..((((.....((((......))))..)))).)))).)))))..))))).....((((..((((((.(((((.(.(((.(((((((...........((((((..((((((......))))))..))))))...)))))))))).).)))))..((((((....)))..))).((((..(((((((((.((....))))))....(((((((((.((((.....))))..)))))))))(((.(((((....))))))))......((.(((((.........))))).)))))))..))))..(((....)))........))))))..)))).........(((.((..((((((.....)))))))).))).....))))))))))))))))))).(((((((....)).)))))....)))))))..))))).((((((((((...)))))))))))))))).)))))))........((((.(((((...((.((((((((((((..(((((.((((((.......)))))))))))(((((.....)))))..................(((.((..((((.(((.(((...(((((((...))))))).....(((.(((...((((......))))))).)))((((.((((((((........)))))..)))))))((((((.....(((((((.......))..)))))......)))))).((((((....))))))(((....))).....))).))).))))..))))).....)))))))..))))))).))))))))).)).)))))))).).(((((((((..(((((((((((((((((....)))))))))))..))))))...)))))))))...........)))))))....))))..
Thermodynamic Ensemble Prediction
{(((..(((((((,,((((((((,({((((((((((((((({((.((((..((.(((((((.....)),,))))..)).)))).))))((((((((((...((((((,,{((((((((.({((.(((((.((.((,(({.(({{{((((((((((((((,,{(....}}||{{((((,,((({{{{{|...{||((((((....)))))},.((((((......)))))|((..((((((((((((((........))))))..(((({.(((((((...)))))))....))).}})))))))).}}|}}}.,,.),)))}}})}))))))|}(((((.,.....}.))))).,{((((({(((({{.{{{..((((({...}))))).}}||||||,,,,...|{(({{(((......({((({((.(({.{((((........(((,...}))),.....))))).,})).))....))))))))))).))}...{,{{{{({{(({{{,..{.{((,,..|||,,{{{.||||,..))}).)))..,{{{,,{((((({((((((((((((({|,{(((((((.(((....))).))).)))).},)))....))))))))))))||.,}))|})),.,,|{{{{.,......})))),}||||||,{,{({(((({,....,))))},}}}|..}}}}}}))}}}}}.|||{||||||||....||}....|||}|}|})}}})}|,.......,)))}}})}(((.((((.(((.{{,.{((((..,..........)))))}}))).)))).))).(((((((((.(((...))).)))))))))......))))))))))}},}||.||...((((((,....(.((.((((.............)))).)).)}||}}}.....)).))),)).)),))))))).)|)))))))).}}.|}|(,{{.((({....})))...}}..{(({..((((((.{((((.(.((,{((((({,........,,.((((((..((((((......))))))..)))))}..})))))))))).).))))){,{||{{|,,|,}}},||},}|||,.,||||.{||{}||,..,)))))).||.(((((((((,((((.....)))).,))))))))}((|{(((((....))))))))..,,,,}}}|||{|,.,,,.,.,)}},,,|{{||||,,,,....},}))}..}}}},,....))))))..}}}}...,,,.,|(({..,..(({{{|,,,,,))))))}}.,,,....,,,{((((.....)))))...(((((((....)).)))))}))))).)))))).)))).((((((((((...))))))))))))))))))))))))........{{{{.{{{{|...(((((((((((((((..(((((.((((((.......)))))))))))(((((.....)))))..................(((,((,.((((.(((.(((...(((((((...))))))),,...{({,(((...,,(({..,,,,,,,))).)))(((,{((((((((........)))))..)))),))},,,,,.,,,,(((((,,.,.....}}..))))}.....,))))|((((((((....))))))))}....)),.....))).))).))))..|)))}.....)))))))..)))))))}))})))))),)),}))))))},|.(((((((((..(((((((((((((((((....))))))))))),.,))))),,,))))))}))...........)))))))....))))..

Transcripts

ID Sequence Length GC content
AGAAGAAGUUUCUAGGCGCGCGUGCCCUGGGUUUAUUAAGCUCCUGGCU… 1861 nt 0.5218
Summary

The protein encoded by this gene belongs to the superfamily of small heat-shock proteins containing a conservative alpha-crystallin domain at the C-terminal part of the molecule. The expression of this gene in induced by estrogen in estrogen receptor-positive breast cancer cells, and this protein also functions as a chaperone in association with Bag3, a stimulator of macroautophagy. Thus, this gene appears to be involved in regulation of cell proliferation, apoptosis, and carcinogenesis, and mutations in this gene have been associated with different neuromuscular diseases, including Charcot-Marie-Tooth disease. [provided by RefSeq, Jul 2008]

Forensic Context

A study in porcine skin demonstrated that the HSPB8 was significantly decreased in all four bromine exposure groups (45 s and 8 min at 24 h and 7 d) [Price et al. DOI:10.1016/j.toxlet.2008.08.007]. In a separate investigation of sulfur mustard and thermal burn injuries in porcine skin at 7 days postexposure, the HSPB8 was also found to be significantly decreased in response to both HD and thermal exposure [Price et al. DOI:10.080/15569520903097754]. A study in humans demonstrated that the HSPB8 was downregulated during long-term weight loss (0 to 12 months) in weight losers within subcutaneous adipose tissue [Bollepalli et al. DOI:10.1038/ijo.2017.245].