Basic Information

Symbol
HSPG2
RNA class
mRNA
Alias
Heparan Sulfate Proteoglycan 2 Perlecan PRCAN Basement Membrane-Specific Heparan Sulfate Proteoglycan Core Protein Perlecan Proteoglycan HSPG SJS1 PLC Schwartz-Jampel Syndrome 1 (Chondrodystrophic Myotonia) Endorepellin (Domain V Region) Endorepellin SJA SJS
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Sudden unexpected death diagnosis

MANE select

Transcript ID
NM_005529.7
Sequence length
14341.0 nt
GC content
0.6452

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-6400.30 kcal/mol
Thermodynamic ensemble
Free energy: -6630.10 kcal/mol
Frequency: 0.0000
Diversity: 3104.80
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.(((((((((.(((.....))).))))).)))))))).....(((((.(((((((((.(.(.((((....(((.((((((((((((((((((((((((((((....((((.(((.((((((.((((((((((((((((((.(((((..(((((((((.....(((((...((((..(((((.(((((((((.(((.((...(((((...(((.((((..((.....)))))))))......((.((((((....)).))))))((((((.....)))))).......((((((((((....((((((((.((((..((((((...((....))....)))))).)))).)))...((((((((((((((.(((.((((((((((..((((((........)))))).)))...((.((....)))).))))))).).....)).))))))..))))....))))..)))))....)))))))))).((((.((.((((.(((((((..(((((((.(((((((((.((((((((....((((((((((.((((((((...((((((((((.((.(((((((((......)).)))))))...)).)))).))))))...)))..(((......))).)))))..)))))).)))).((((...)))))))))))))))))))))))..((((((.......)))).)).....((((((((((..(((.(((((.(((...(((((.....)))))...))).))))).))).........)))).))))))((((.....))))((((....))))..)))))...))))))))))).)).)))))))))...)).))).))))))))))))))))))..)))))....))))))...)))...)))))))))(((((..((.(((((.(((((((((((...))))...))).))))(((((((......)))).))).....(((((.....))))).))))))).)))))..)))..)).)))))))).).))).)).).))))))))))))))))))))).)))).....((((((....)))))))).).))))))))))..((((.(((((((((((((((((...((((..((((...................((((((..((((((...(((.((((.((((.(....).)))).))))((((((.(...........))))))).)))...))))(((((((((.((((((.(((((((((((......)).))).)))).(((.....)))......(((((.(((.((...(((((((.((.....)).)))))))(((((..((((((...))).)))..)))))...)).))).))))).(((........))).(((((.....))))).....((.((.((((...(((((((((((....((.(.((...)).).)).))))).))))))..)))).)).)).(((((..(((((.((((.....((((.((..((((..(((.(((((((.((....((....))..)).))))))).).))))))))))))...)))))))))..)))))((((((....((((((.((.....)).(((.((((((((((((..((((((((((.(((....)))))))))))))......((.((((((....(..((((((((((.((.((..((((..((....)).)))))).)).))).))..)))))..)..))))).).))............((((((((((.((((((...((..((((((((..((((((((...............((((((.....((((((.......((((((..(((......)))..)))))).......))))))......)))))).....((((....))))..((((((........))))))..))))))))..)))))).))..))..(((.((((((((((((..((((...(((((.......)))))...)).))))))))((((((((((.......)))))))))).........)))))).)))((((((((((((((.((((((((((((((((.((((((...((((..((((((((.((((((((.(((((........(((((.((((...))))....(((((..(((((((.....(((....))).((((......))))..))))))).....)))))((((((((((...((((((.((((.((((.((((((.((.(((..(((.((.......)).)))((((((..((((.((((...((((((((((((((...))))).)))))))))...((((((((((((((.((((((((((((.((....))..))).))))))))).)))...))))).)))).))....))))))))))))))(((.....)))..(((((((.(((.(((((..((((((..(((((.(((((((((..((..((((((((((((..(.((((.((..((((((((.((.((((((..(((....(((((((..((((.((((...))))........((((((((.((((......))))(((((((((.((......(((((.((....)).)))))......))))))..)))))...))))))))))))...)))))))...))).(((((.((....)).))))).)))))).)).).)))))))....)).)))).)..))).).))))))))))....((((((((.((((((.((((((.........)))...))).....(((((((((((((..........((((.((((((.((((((.(((((((..(((((....))))).))))..))).)).(((((((((((.((.((.((((((........))))))..((.(((.((.(((...(((.....((((.((((((.(((((((.(...((.(....((((..((((........((((......))))............))))..))))....).)).).))))))).)))))).))))...))).)).).)))))))......))..)))))))))))))....))))..)))))).)))).)))))))))))))(((((((.(.(((............))).))))))))..(((((..((.((...)))).)))))...)))))).))))))))((((....(((((((.((((.((((.((((...(((((((((.((((((((((....)))).)).)))).((((((((((((..(((..(((((..(((((.(((((..(((((((.....)))).).)))))))))).)).....(((.(((((.(.(((((((((.((.....(((.((((....((((((.........)))))))))))))..)))))))))...)).))))))))))))))..))).....((((.....((((.(((((((((((........((((.(((((.....))))).))))..)))))))..).))).)))))))).......))))))))))))(((((.((((.((((((.(((....))).))))))..((((((.....)).))))..((((.(.((.((((((((.(((..(.((....)).)..)))))))))))..)).).)))))))).))))).))))))))).........((((....)))).)))).......)))).)))).))))))).))))(((((((.....))))))).)))))).)))..)))))..))))))..)))))((.(((((..(((((((.(((((((.((((...((((.(((..(((((.......)))))..)))...))))((((((((((....((((((((((..((((.(.((((((((..((((((((((((((......((.((((...)))).))........)))))))))).).))).(((.((.....)).))).((((((((....))).))))).......((((.((....)).))))........(((.(.((((((.(((((((((((((((((((((((((((.(((...))).))).....((((((.(((....((........))....))).))))))......((((.(((((.((...)).)))))..)))).....(((......)))...)))))).(((.(((((....))))))))....)))))).).)))))))).(((((.((((((((((.((.....))..)).)))))).).).)))))....((((((........))).)))....))).)))))).)))).....((((....(((.(((((..((((....))))..))))))))..((((((.(((.((...(((.(((((....)))))..))).((((((((....))..))))))......))))).))))))))))))))))))))))).((((((((..((((.(((((((......(((((((((.(((((((((((.(((.(...(((((((((((((.(((.((...((((((((((((..............((((((((((((.((.(((((((((.(((((((........(((.(((((((.((((((((.((((((.((.(((((((..((((..((((..(((.((........(((((((..(((....))).((((.((........))))))(((((...)))))....)))))))..((((((((((.((((((((.....)))))).)).))))))...))))......)))))..))))..))))..)))...(((.(((.((((...(((((((((..((......(((((.......((((((.(......).)))))))))))))..))))))))).))))..))))))(((((((.((((((((((..((......))..))))))))))..)))).)))(((....))).))))))..)))))))))).)))).))).)))).)))........)))))))(((((..........))))).((((((.(((....(((((((((((((.((((......))))..)))))))).)))))(((.((....)).))).(((((....))))).))))))))).))))))))))).((.(((...((..(((((((.(((((....(((((((((((.......)))))))))))(((((....(((((((((............................))))).).))).((((((((.((((.......)))).....))))))))))))))))))..))))))).))...)))))...(((((((..(((((.......(((..........))).((((...(((........)))..))))..(((((((...((((..........)))).(((((........)))))........(((((((........)).))))).)))))))......))).))..))))))).....((((((((((....(((((...))).))...)))).))))))...((((.((((((.(((..(.((((.((((..(((...(((...(((((...)).)))...)))...))).))))..)))).)..)))..)))))).)))).....))).))))))).))...))))))))))))((((.((((((((((..((((((...((..(((.(...((((((((((((.(((((.(.((...(((..((((.......))))..))).))).))))).).)).)))).)))))).)))..)).)))))).....)))).)))))).(((((((..(.((((...((....))....)))))..)))))))...))))))))).)))))))).)))))...).))).))).)))).)))).)))........)))))).((..(((((...)))))..))...)))))))))))..(((.........))).....))))))))))).))))))).)))))))))).)))))))..))))))))))).....))))))).(((...))).((((..((((((....))..)))).....)))).))).)))))))((((((((((..((.((((((........(((((((...)))))))......)))))).))..)))).))))))((((((....))).)))(((((...)))))....))).))))))))..))))))))))))))...)).))))))))...))))))))))...))))).)))...(((((...(((((....(((.(((((..((((((.((((((.((((((....).)))))..........)))))).))))))))))).))))))))...))))).(((....)))....))))))))))))...)))(((.((((((.(((.((........)).)))((..((((.......))))..))(..(((((((.((((((((((((((....(((....)))....))))))).........))))))))))))))..)....)))))).))).))))))))))).)).....))))))))))))((((........))))....((.((((.......))))))(((((((.((.(...(((...))).))).))))))).......))))))))..........((((.((..((((((..((........))..))))))..)).)))))))))))))))))))).))))))))))))(((((((((.......))).....))))))((((((.....))))))))).))))))..))))))...(((((.........))))).........(((((((((...((..(((((((((..(((....(((..(..(((((((.....((((.(((...))).))))..)))))))..)...)))....)))))))))).))...))...))))))))).)).)))))).)))).))))).))..))))))..(((((((((((.((((.(((((((.((((((.....(((((...((((((.......)))))))))))......)))))))))))))((((((((((.((.((((..(((.((....)).)))((((((((((((....)))).))(((((((.((((((((((((((.(((...((((.(((....)))))))....))).)))).(((((((.....)))))))...((((((..((((.(((((((((.(((....)))..)))).....))))).))))..))))))((.(((((...((......))...))))).)).)))))))..))).)))))))...))))))..((((((..((((..((((...))))..)))).)))))).((((((...)))))).((((..........)))))))).).).)))))).)))).)))).))))))..)))))...))))))))...)))))))))..)))))))).)))).)))))).))))(((((((.(.((((((((.(((...(((((((((.....((((((((.(((...((.(((...((((.((......((((((((...))))))))...........((((((((..(((((.((....)))))))(((((((((..(((.....)))....))))))).)).....))))))))(((((((.((((((((((.(.(((((...)))))).....(((.(((((((((.(((((((...((.(((((((.........(((((.(((((.(((..(((((((((.((((((((((((((((((..((((..((((.(((((((....))))..))).))))))))...(((((((.((((.(((((((.(((((.(((((..........((((.(((.((((((((.((((.......................)))).)).)))))).))).))))...))))).)))))...((((((.(((((((.((...((((..........(((((((((((..((((((((..(((..((((((((((((.(.((((((.........)))...((((......)))).........((((........)))).....))))..)))))))))...)))..))).....)))).....(((((......))))).(((((((((((((.(((((.(((((((((......(((.......)))((((((((...))))))))..((((.((((((((((((.....))))).).))))))))))((((.((((((((((.((((((....((((((.((.(...(((...))).))).))))))))))..)).))))))))..)))))).....(((((....)))))............(((((.((((........)).)).))))).((((((((.......(.((.(((((((.(((((((.((((((....(((....)))....))))))(((...))).)))))))))))))).)).).(((((((....)).)))))..))))).)))...))))).)))).)))....)).)))))))))))))(((((((.((((((((.(.((((..((((((((((((....))).))..(((((((..(((((((((..((((((((..(((((..((((((...(((((((((((.((((((...(.((.(((((.(((((....(((.(.((((((((((((((((.(((((......))))).((((...((((.(..(.(((((((.....))))))))..).))))))))...((...))(((((((............(((.((((......)))).)))...(((.((.((((((((((.(((....)))))).....((((....))))......((.((((((((((((..(((((..(((((((((((..((.((..((((.........)))).))))...(((((((....(((((((..(((((((((((.((...((((..(((((..((((((...........)))))).)))))......(((.(((((.(((((.((((...))))...))))).))..))).)))........(((((((((((...((((..(((....((((....)))).)))..)))).....))))))))))).((((..(((.((.....))))).....((((((((.(......).))))))))(((((.((((..(((((.((((((.(((.......))).))))(((((.((((((..((.((..((.((((((.((((..((.(((((((((((((...(((((((((((.((...(((((.(((((((....((((....(((....)))(((((.(((((....(((.((((((..(((.(((..(((.....((....((((((((((.......)))..)))))))....))..)))..))).))).....(((((..((((.((.((....)))).)))).....))))))))))).)))(((((((.(.....((.(((((......))))).)).....).))))))).....))))).)))))..((((.(((((((((....(((((................)))))))))).)))).))))............((((((((((.((((((((((.((.(((((((.....)))....))).).)).))))))))))))((((((((.........(((((((((((.(((((((((....(((.....)))......((((((((.((((((((((..((((.(......)))))..))))).(((((((((....(.(((((........))))).))).)))))))((((((((((((((..((....)).))))))).).)))))))))))..))))))))......((..(((((.(((.((....)).))))))))..))....)))))))))(((((.((((((.(.(.((...)).).).))))))....)))))....((((((.............)))))).......))).))))))))....)))))))).......(((.....)))(((((((((...(((...))).))))).)))).....))))))))))))..))))))).)))))))..))))))..))))).)))))))).))))).))))))))))))((((....((((.....))))...))))..))..)).))..)))))).)))))))))))).)))).))))).)))).))))...))...)))))).)))))..)))))))...))))))).........(((...((((((((...((((((((........))))))))......((((((((((...(((((.((((((((.(((.......))).))....)))).)).)))))...))))))))))))))))))))))))))..)).))))..)))).).....))))).....))))))).))...))))))).)))))...)))))))))))))))))....((((((((.((.(((((((..(((.((((.((((......(((.....((.(((..(((.(((((..((((.(((((..(....)..))))).)))).))))))))...))).))..)))...)))).)))))))((..((.((((.((.((((((((((((((((.((.......(((.((((..(.(((..((((.......))))..)))...)..)))).)))..((........))..(((((((((....))).))))))..)).))))))...(((.((((((((((((......(((((..(((.(((.(((.....(((((((.((((((..((((((((..((((..(.((........)).).((((((..(((.((...(((((.(((((((((((........)))))....(((((...(((.((((((......)))......)))..)))))))))))).)).)))))...)).)))))))))...(((((((.(((((((.(((((((.((.(((((........))))).)).....(((.((((((((.............((((..((((...))))..))))...(((.((((((((((.((((......))))))))))..))))))))))))))).)))....))))))).))).))))..)))))))..))))...))).)))))....)))))).((.((((.....)))).)).)))))))......)))..)))...)))..))))).....)))))(((((.....)))))(((.((((...(((((((.(((..((((.((...((((((....(((.((((......)))).)))...)))))).))))))..((((((((((((.((((....(((.(((((((((((((.((((((....)))))))))).).)))(((((((((((((..........))).))))))))))...))))))))..(((((..((((((....))))).)..))))))))).)))(((.....)))..)))))))))))).))))))).)))))))......))))))).))))))))))))))).))))))..)).(((.......)))...............)))))))...))..)))))))))))))).))))...(((((....))))).))))).))))))).)..)))))).))))))..((.((((.....))))))..))))))))))))))))))))))))........))))..))))).))))))).(((((((((((.(((((.((((.(((((...))))).))))..)).))))))))))))))........)))))))..)))).))))))...(((.((.(((((((((((.((.....)).))))).....)))))).)).)))..((((((((.(.......).))))))))(((((..(((((((((((.(((((.((((..(((...(((........)))...))))))).)).)).).))))....)))..))))..))..))).)))..))))))).))))..)))))))))))(((((.(((......((((.......))))...))).)))))....))))))))))))).))))))))))))).)))))))).)))..)))).)))).).))).......)))))))))...).))))).)))))))).))))).((((((((....((((((....(((((((...(((((((.....((.......))..))))))).((..((.(((.(((((((..(((((((.(((((.((......))..)))))...)))..))))..)))))))))).))..)))))))))))))))))))))))..........)))))))))......(((......)))...)))))))...))))))))))))...))))))))....))..)))))))....)).))))....(((((((((.(((.((((((((((((.(.((.((((((((..((.(((((.((..(((((..((((.(((((((.((((((((.((((.(..((.((.(((((.((((..((((.((((((.((..((((.((((..(((((...)).))).....(((((((((((((((((((((((.(((.(((((((((((.((((((((..((........))...))))))..)).)))))).((((((.((((....((((((...((.((.((.((((..((((......))))..)))).)).))))))))))..)))))))))).....))))))))))...........))))....)))))))))..))))).))).)))).))))..))..)))))).))))))))))))).))))..).)))).(((.(((((........))))).)))....((((((....)))))).......((....))((((...))))..((.((((...)))).))((((((....))))))..........))))).)))...)))))))))))....((......))....(((..(((((((..((((((((((..(((................(((((.((..(((....))))).)))))(((((.((((((.((((.(((((.(((.....(((((.....))))).((((.(((.(((((((..((((((........)))))))))))))...)))))))...(((((.((((((((......))))).))))))))(((((((((((.(((((((((((((((....)))((((......))))(((((((....).))))))....((((((..(((....(((((....)))))..))).))))))..))))))))))))..))....))))))))).......((.(((((....)))))..))))).))))).)))))))))).)))))...)))......)))))))))).)))))))..)))........(((.((..........)).))).)))))))))))).)).)))))))))))))))))))).....)))((((((......))))))((((.(((((((..((......))..)))))))(((..((((.....(((...))))))).)))...((((((........)))))).)))).(((..((((.(((..(((......)))..)))..))))..)))..((((((..........))).))).))).)))))))))((((.....))))..)))))...))).)))).)))))))))))............))..))).)))).)))).))))))))..((((..((((((((((..((......))..)).))..))))))..)))).(((((.....)))))(((((((((.........))))))))).((((((((....).))))))).....((....))..........)))))...)))))..
Thermodynamic Ensemble Prediction
((((.(((((((((.(((.....))).))))).))))))))((((.{,((((((.((((.((..((((({{.....|.((((((((((((((((.(((((.(.(((.((((((.((((((..,.(((.((((.(((.(((({(((((((((((((((((((.....(((((...((((..(((((.((((((((({({(.((...(((((,..(((.((((..((.....)))))))))......((.((((((....)).))))}}((((((.....))))))|}},.,.((((((((((.,..((((((((.((((..((((((...((....))....}))))).)))).))}...{,{{(({(((((({.({{{({({(((({(.,(({{{(,.......|||}}}.}}}..|{|.|,}},,))}},)))))}),}.,}}.}},)))))}},)))}...,}},,.,)))))....)))))))))).{(((.((.((((.(((((((..(((((((.(((((((((.((((((((....((((((((((.((((((((...((((((((((.{(.(((((((((......)).)))))))...)).)))).)))))),..))),.,{{.,,,..}})})))))..)))))).))))|((({...}))))))))))))))))))))))..(,((((.......)))).||{{{{{(,{,,{,{||,||||,(((((.(((...(((((.....)))))...))).))))).}}},.},.,},,)}||..,}}}}{(((.....))))((((....))))..)))))...))))))))))).)).)))))))))...)).))).))))))))))))))))))..)))))....)))))){{.((((((((.(((((((,((((.{.((((((.(((((((((((...))))...))).))))(((((((......)))).))).....(((((.....))))).))))))}.,).)))..)).})).((((...((((((((...((((((((((((((....((((..((((.....((((((....)))))).......((((((((..((((((((((((((((((((((...((((({.(((((,,...{{.{{..((....,||..}}.},.||))))).,((((.((((.(....).)))).))))((((((.(...........})))))).((((((((((,{.((,((..,((((.((...)).))))...)).}),)..)))}}})))))((((((((....(((((.(((.((..,(((((((,({.....)),)))))))|((((..((((((...)))}}))..))))}...)).))).))))}.(((........))).((({(....,)))))....,{{,((.((((...(((((((((((.{{,{(,.,,,...})})}),.))))).))))))..)))).)).)),||,,...{{((({(,,,.|,}}}}}|.|||..,,...))),))))))))......(((.((((((..((((.(({{(((((.((((((({,((.,(({,((.((((((((((......{((((((((({..({(,.((({(((((((((((,..((((((((((.(((....)))))))))))))...{.,({..(((((....{..((((((((((.((.((..((((..{{....},.)))))).)}.))).)}..)))))..,.,))))).,.}|,........,{.((((((((((.((((((.,.....,,((((((..((((((((.,({{.,,,,{,,..((({{{.....((((({{{.....{({(((,.{{{,,,,,.}))..)})))),.....,)))))).....,||||||{{...((((.......,))||,,,|}},,,,},})))))..))))))))..)))))).||(((((,({({,((((,,(((,(,,((({...(((((.......)))))....,.||||||||((((((((((.......))))))))))(((((.(((....))).))))),.,..((((((.((((((((((((((((.((((((,,.((((..((((((((.(,((((((.(({,(,{{{...{((((,.((((...))))....(((((..(((((((.....(((....))).{(((......))))..))))))).....)))))((((((((((...((((((.((((.((((.((((((.((,{((..((({(({{{{.,{||..,.((((((..((((.((((...((((((((((((((...))))).)))))))))...((((((((((((((.((((((((((((.{{....)}..))).))))))))).)))...)))))},))).}}....))))))))))))))|||...,}}|||.((((((({({{{(((((..((((((..(((((.(((((((((..{{,.((((((((((((..(.((((.((..((((((((.((.((((((,.(((...{{((((((.,((({.((((...))))..,}}|..((((((((.((((......))))(((((((((.((..,...(((((.((....)).)))))...,..))))))..)))))...)))))))),}))...)))))))...))),(((((.((....)).))))).)))))).)).)})))))))....)).)))).)..))).).)))))))),}..{,((((((((.((((((.,(((((.........)))...,,}.....(((((((((((((...{(((...,{{{,(((((,,(((,,,.|||||||,.(((((....))))).}}||.,,},.||.(((((((((((.((.((.((((((........))))))..{,{((,,((.{{(...(({.....((((.((((((.(((((((.{...(,{({,..((((..((((........((((......)))),...........))))..)))),}}.).),.,.))))))).)))))).))))...))).)).).))))))}......))..)))))))))))))}}.|))),..}}}})).,))),)))))))))))))(((((((.(.(((............))).))))))))..(((((..((.((...))}),))))),,,)))))).))))))))||{{....(((((((.((((.((((.((((.{.(((((((((.((((((((((....)))).)).)))).((((((((((((..({{,.{{((((((((((.(((((..{({((((.....)))).).)})))))))).)).))}}|{{.||{{{,({(((((((((.((.....((,{((((....((((((.........)))))))))))))..))))))))).,,|)|})|||||}},)))),.}}}.....((((.....((((.(((((((((((........((((.(((({.....})))).))))..)))))))..).))).)))))))).......))))))))))))(((((.((((,((((((.(((....))).))))))|.((((((.....)).)))).|((({.{.((.((((((((.(({,,(.({....}}.,.,)))))))))))..)).}.)))))))).))))).))))))))).........((((....)))).)))).......)))).)))).))))))).})))(((((((,...,))))))).)))))).)))..)))))..))))))..)))))}..||})}}}|||,||}}||||,{,.{((({{{((((.(((,.{((,({{,....}}}}|,,||,..,|||,((((((((((....{(((((((((.,(((({({(((({(((..(((((((((((((({,,...,,.((((...)))).)),.......)))))))))).).))).}}|.,.{{{{.(((((((((((((((....))).)))),.......((((.((....)).))))........(((((((..(((((.....,,..(((((({(({{(,.(((.(((...))).))).,...((((((.(((....((........))....))).))))))....,||,}|},||||,||..,},.,,,....((({....})))..{{{{|,...}))))...(((.(((((....))))))))....,,,})))))..)))))))(((((.{{((((((,(..{........,,.,)))))).}.}.)))))....}))))))).....}}}}.,{({(.{|,....},)}}))),.....,,.....,(((.(((((..((((....))))..)))))))}.,((((((.(((.((.{..,,.(((((....)))))..}||.((((((((....))..))))))....,.))))).))))))..)))))))))))),,,.((((((((..((((.(((((((...,,,(((((((((.(((((((((((.(((.(...(((((((((((((.(((.((...((((((((({{{.....,..,{{...((((((((((((.((.(((((((((.((((((({{,.....(((.(((((((.((((((((.((((((.{{.{{{{((({{(,(({.((((,,,,{.{{..((({{.(((({{(...,,,..,))).|||||((...,,,,,|}|||}(((((...))))).,,,|||||||..{{{,((((((.((((((((,...,)))))).)).))))))..,||||,.....}}}},.,))},{{|||||.|||...(((.(((.((((...(((((((((..((......(((((.......((((((.({.....).)))))))))))))..))))))))).)))),.))))))|||,,||,||||{{{{||,,{{....,,)),,)))})))))},,)))).,})|||}...))).))))))..)))))))))).)))).))).)))).))).,|,,...})))))){((((..........))))}.((((((.(((....(((((((((((((.((((......))))..))))))))))}))),{{.,,.....,.,)),{{{|{..,,))))),))))))))).))))))))))).,,.(({.,.,,..(((((((.(((((....(((((((((((.......))))))))))){{{{{....(({((((((........................,...))))).).))).{(((((((.((((.......)))).....))))))))))))})))))..))))))).},{{||||||...((((,((..,.}}.}}}}...|||||.||.....}}..((((.{,(((........))),.))))..((((((({,.{(((......,,,.}}}}.(((((........)))))..|,,{.,(((((((........)).))))).}})))}}......,|||||.{|||,||{,.,{.|,,}},.|)))}}),)|||}},}},........)))))))))...((((.((((((.(((..{.((((.((((..(((...(((...((({,...,}.)))...)))...))).))))..)))).)..)))..)))))).))))..,,,)))})}))))).))...))))))))))))((((.((((((((((..((((((...((..(((.{{..((((((((((((.(((((.(.((...(((..((((.......))))..))).))},))))).).)).)))).)))))).))).,)).)))))).....)))).)))))).(((((((..(.((((...((....))....)))))..)))))))...))))))))).)))))))).)))))...).))).))).)))).)))).)))........)))))).||,.(((((...,))))}.}}...))))))))))).{(((.........))).,...)))))))))))}})))))).)))))))))).})))),,..,}|||||,|||.....))),)))}|(({{{|,..{||{..{{({{{....||{{|}}}...,,))),))),}))).|||((((((((((..((.((((((........(((((((...))))))),.....)))))).))..)))).)))))))),}))}}}))),,}))||,||.}})))))}..,)}),),))))))..))))))))))))))...)).))))))))...|}}}}}))},...}}})}.}||.,,{{,,|...|}}}{|,..{((.((((({,{{((((,(((((,.((((((....).))))),}},,.....}}}})}.))))))))))).))))))))...,))),,|.|,}}}),)}.,.))))))))}})}...|||||.,{..(((((((.((........)).))}})))).||,{.|||.|||,....,..((((({{{((((((((((((((....(((....)))....))))))),,.......)))))))))))))),,.}},.)))}|}|}.),))))))))))).)).....))))))))))))((((........)))).,}.))}))),...,)))))}}}},{|||||,{{.|,,,,||,,.}}}..}}.}}}})}}......((((.(((.{{(((,,(((.(((((.((....)))))))..)))))))..)})))))))....}.)))))))))))))))).))))))))))))((((((((({....,.))).....))))))(((({{,....||||||((((((({(({{{,(({,.,.|||,,.......{{|{((,.,.......(((((((((...((..(((((((((,,(((....(((,.(..(((((((.....((((.(((...))).))))..)))))))..).,.)))....)))))))))).))...})...))))))))).(((((((.((.{....}.)).)),,)))).},.}}))))..})}}}}}}.)))))}}}))}}}}.,,,.|||||..((((((((((....(((((((||,......{{{(,((((((,,{((..(((((....(((((,{{(({(...,,.{(((,,,,((((......)))).).}))),|}.,)})),}},)))))..}})))..}}}.({(((.{{.((((,{{{{,.(((((((((....))))))))),,}},},,.((((((..((((.(((((((({.(((....)))..)))).....))))).))))..))))))})}|,,|}...|}}}},.}))})),)))))))))))....)))))))))).,..)})})))|||{|||||.,{(((..((((...))))..)))}.)))))}.})),)))))))))))......))))..)))))).))...).)).,)))))))..)))))))))))))))))))))))).)))))...)))))))))..))))))))..(((((...))))).(((((((((((((.{(...)).))).....,..,,{{...(((.....)))....))))))))))))).(((({...((((((({...}))))))),((((((,((.,{{{((|,,...||.|||}.}},,,,.{(((((((.((.(((..{{((((((((((.(((.((((.,((((((((((.(((((((((((..((({({({(((((...)))))..{{.(((((((((((((....))).))).)).,))))).}}.......(((((.(((({,(((..(((((((((.((((((((((((((((((.{((((..((((.(((((((....))))..))).))))}))}}..(((((((.((((.(((((((.(((((.(((((..........((((.(((.((((((((.((((.....,,.........},.....)))).)).)))))).))).))))...))))).)))))...((((((.(((((((,((,..({{{..........(((((((((((..((((((({,{(((..(((((((((((({(((((((..((......))..))))).))}...,||{,,,..,...{(((........)))}...}}))},..)))))))))...)))..))}.,.,,)))).....(((((......))))).(((((((((((((.((({(,(((((((((,.....(((.....,,|}}((((((((...))))))))..((({{((((((((((((.....})))).),})))))))))((((.((((((((((.((((((....((((((.((.{...(((...))).,)).)))))))))},.)).)))))))}.})))))).....(((((....)))))..,{{{..,,..(((((.((((........)).)).))))).||{{{{||,||.,..{.((.((((({({(((((((.((((((....(((....)))....)))))|(((...))),)))))))))))))).)).}.{(((({{....)).)))))..}}))),)))}}}))))},|||}.}}),,,.}}.)))))))))))))(((((((.((((((((.(.((((..(((((((((((,....|}|,}}..(((((((..((((({(((..((((((((..(((((..((((((,..(((((((((((.((((((.{.(.((.(((((.(((((....(((.,.((((((((((((((((.((({{,,...,||}}}.((((...((((.(..(.(((((((.....}))))))}..).)))))))),,}||},,}}(((((((,,..,,{,,{({(({.{{{{......}))).))).,,|{{,({.((((((((((.(((....)))))).....((((....))))...,..((.(((((((.((((.{(((((..(((((..,,,.}}||}||}}((((.........)))).||||.{{{((((((.|..(((((((..(((((((((((.{..{{{({((,(((((.,((((((......,,,,,}}|||}.}}||}.},...{{{.{{{((,(((((.((((...))))...))))).)|..})),))).,..{(({({(((((((((...((((,.(((....((({....}))).})},,)))).....}}}}}}}))})|||{,|{|||.{|||}|..((((.{.{.((((((((.{......).)))))))).}.}.))))}})))}}},||||||.,((,,,....||}.}}}}|((((,{(((({.,((.(({{((.((((((.(((,.{((.(((((((((((((...(((((((((((.((...(((((.(((((((....((((..{.{((....}},{.((((((((..{,...,,}}.}}.....,.{{.{{.((((((((......)))))}|))}}.},..}|.,,.((((((((((((..,{.((((((((((..(((((....(((({((..({{{{...)})))..{(((,|,...,||}}.,..(((((((.{.....((.(((((......))))).)).....}.)))))))....))),))})))))..)))).)))))),|,,{{{((((.{..(((((.(((,{((({.{{.((((..((..(((((.....))))).}.)}))))||.((((((((((.((.(((((((.....)))....))).).)).)))))))))),,((((((((.........(((((((((((.(((((((((....(((.....))}......((((((((.((((((((((..((((.(......)))))..))))),(((((((((......(((((........))))).})).)))))))((((((((((((((..((....)).))))))).).)))))))))))..))))))))......{(..(((((.(((.((....)).))))))))..)}....)))))))))((((({((((((.(..,.,...,..)..,)))))),},.}))))....((((((.............)))))).......))),,)))))))....))))))))....,.))}.).))).)))))})))).)}).}..,,.)))))))))))),))},,))),))..))))..))))))).)))))))..))))))..))))).)))))))).))))).))))))))))))((((.,..((((,...,)))).,.))))..}}..}|,}}..}}}}}},))}|||,}}|||.||||{((,,..,,|}}}}))),,,})}.})))))},))))..))))))).}.)))))))........|||{...{((({{{{|.,|{||{{{|,...,,},)))})))).,.,,,,{((((((((.,|(((((.(((({{{{.{{{|,.....))),))....)))).)),)))))}.,))))))))))))))})})))}}||||||},.,})).,))),.}.....,)),))))..))))))).))..,))))))).)})}}...)))))))))))))))))....((((((((.((.(((((((..((,{((((.((((..,,..(((...{,,(.(((..({(,(((((..((((.(((((..(....)..))))).)))).))))),))...))),})}.))).,,)))).)))))))((.(((((,,,,||}}||{{,((({,(({((,{{.....||{||.{,{||||,,{||.((((.......))))(((({,......,}},}}...({........}}..(((((((((....)))))))))),,})}),||||..,(.((((((((((((........,,(((,{((,..((.((((((((((((.((((.{,,,...(((((({..,,(({((.,.{,.......,}).,|}}}}..((({((.{{(((,{{(((,.((((((({.....{({|||..{{{,(({{{{((..{,,....,..}})))...,,.})).}))}},,,,,.}},}}.{({|{{{{||.,|{|||.||{{{(((((((.(((((((.(((((((.((.(((((........))))).)).....(((.((((((((....,{{{,.,,,((((..((((...))))..)))){{{((,.,(((,{,,{,.|||{,.,}}})},,})))},.})))),,,)))))))).)))....))))))).))).))))..)))))))..,|,|{{,||,.}})),......)),))),)))}}...}})))))))})))))))},}}}},))}}).)),,))).,||||||,|||{(({{({((,{{{,((,..,,.|||}.,,..}})),.}),},},)||}))}}},..}}}}},,,|,||{|||.,{{{|||,|{{{{..|||||||,,|}}||,},.|||||,|,||{||,{|...(({,((({{((((((((.((((((....)))))))))).).))){{{|||{||{{{{...,,,..,.))).)})))))))).,.)))))))},}|{|||..||||||,,,,)))}}.|{{,,,,}..))}||}|||.,,.})))})}},})))).)))))}..})))))).))((((((((........)))))))))))),))),,........)))))))))))),}}},,,.........)))))))...))..)))))))))))))).,)))...(((((....))))).))))).))))))).),,)))))).)))))).,{(.((((.....))))))..))))))))))))))))))))))))........)))}..))))).))))))).((((((((((({(((,(.((((,{((((...))))),}))).,,)})),)))))))))))........)))))))..)))).))))))...(((.((.(((((({((({.((.....}}.})))}..,,,)))))).)).)))..((((((((.(.......).)))))))){((((..(((((((((((.(((((.((((..(((...{(({.......,)),.,))))))).)).)).).)))}...,))),.,)))..))..}}).)))..))))))).))))..)))))))))))(((((.(((..,...((((,....}.))))...))).)))))....))))))))))))).))))))))))))).))))))))},))..)))).)))).).))).......))))))))).,.}.))))).)))))))).))))).))},,)},..))}.)))))).))))).))))))..)))).,.)))).))).((((({....(((.((..((.(((.(((((((..(((((((.(((((.{,,,...,),..)))))...)))..))))..)))))))))).))..)).)))...))))))...)))))).....,}})))}(((((..((((.(((((..((((((.(.(((((((((.,,.((((((.(((({,,..{,,}||,|}(,((,({{((({.,,,|,..,.,,})}.}}))})))}.)))).)))))).).)))))}.}))).}))))))..))))).))))..))))){(((...))))..((((((((...))))))))..))).)).)))))))}))))))|((((.....))))}.}))))............)))))))).))))).)))).))))....))))).))))))))).))))}})))...))))..)}))))))))}))))))))))))((((((.((((....((((((...(,{((.((.((((..((((......))))..)))).)).))))))))))..))))))))))...{(((.{.(((.(......).))).)...)))}})),)))).)))..))))))).,.))))))))))))))).).)))))))).))))..)).)))))))..(((.(((((........))))).))).}))||,,||.,},))))))}}....,(({{..,,{((({{,({({{{(({(,(({..|{{|{{{((((((....)))))}.,}}.,,,....|}||,,{....{{{((({..}},.))))))),,,),.,,|||..(((((((..((((((((((..{{,................(((((.(,.{(((....))))).))))){((((.((((((.((((.(((((.(((.....(((((.....))))),((({.,((.(((((((..((((((........))))))))))))).,,))}))))...,,{||.((((((((......))))).)))}||||(((((((((((.(((((((((((({((,,..}}|((((......))))|((((({.,.,||||}}}|,...{{{|{{..|||,.,.(((({....}))))..))).)))))),.))))))))))))..))....)))))))))}}.....||.(((({....))))).,))))).))))).)))))))))).))))}...},,......)))))))))).)))))))..|||,,,.((.(((((((..((((((((((.{{,...,,,|.|||(((((.(((((.((.({(((((..(((((.((((,{(({({{(.{{||||||{{((,(((((((..((......))..))))))),,({.,(((({...|||}}.}))}}}}.}}}...(((({{.{,,,...))))}}.)))).(((..((((.(((..(((......)))..)))..))))..)))..((((((..........})}.))).)))}.)})))))))))))))|((.((....))))},)).))))))).))))).{{{|.....)}).}.,..)))))))))).........{((((.......))))|{({{((......}}})),..,.},....))))))).)).,,{{,,,,,}),)))}||||,{||.}}}}}},.)})))),|{,((((((((....).))))))).}}}.{,....,,.........||,}}}..,}))))..

Transcripts

ID Sequence Length GC content
GCUGUCCCGAGCUGGCCGGCGAGCGGGCGGCUGCGGGCGGCGCGGAGCG… 14344 nt 0.6452
GCUGUCCCGAGCUGGCCGGCGAGCGGGCGGCUGCGGGCGGCGCGGAGCG… 14341 nt 0.6452
Summary

This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]

Forensic Context

A study in human heart tissue demonstrated that the HSPG2 gene was significantly upregulated in sudden unexplained death (SUD) cases compared to heart-healthy controls, as identified through whole transcriptome sequencing and differential expression analysis [Neubauer et al. DOI:10.1007/S00414-025-03414-4]. This upregulation is associated with biological pathways including angiogenesis and positive regulation of endothelial cell proliferation, and the gene is also noted to be upregulated in conditions like dilated cardiomyopathy.