| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCUCUUGAGACUUCACUUCAGCUUCACUGACUUCUGGAUUCUCCUCUU… | 532 nt | 0.3571 |
This gene encodes a member of the histatin family of small, histidine-rich, cationic proteins. They function as antimicrobial peptides and are important components of the innate immune system. Histatin s are found in saliva and exhibit antibacterial, antifungal activities and function in wound healing. [provided by RefSeq, Sep 2014]
A study in humans demonstrated that a one-tube, two-step isothermal amplification assay (RT-RPA followed by LAMP) for the HTN3 mRNA enabled rapid, sensitive (0.5 µL saliva, 100 fg RNA), and specific screening of saliva in forensic samples, successfully detecting it in mixtures and most mock forensic samples [Kubo et al. DOI:10.1016/j.forsciint.2023.111847]. Another human study found that primers targeting transcript stable regions (StaRs) for the HTN3 provided vastly improved and consistent detection in degraded buccal/saliva samples compared to conventional primers, which often failed [Lin et al. DOI:10.1016/j.fsigen.2015.09.012]. A study in human body fluid stains demonstrated that the co-extraction method successfully isolated high-quality RNA and DNA from saliva, with the HTN3 mRNA and DNA detectable from the lowest tested volume of 1.6 µl for forensic body fluid identification [Alvarez et al. DOI:10.1016/j.ab.2004.09.002].