Basic Information

Symbol
HTN3
RNA class
mRNA
Alias
Histatin 3 HIS2 Basic Histidine-Rich Protein Histidine-Rich Protein 3 Histatin-3 Hst 3 PB Histatin-4 Histatin-5 Histatin-6 Histatin-7 Histatin-8 Histatin-9 HTN2 HTN5 Hst
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Mixture deconvolution

MANE select

Transcript ID
NM_000200.3
Sequence length
532.0 nt
GC content
0.3571

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-109.40 kcal/mol
Thermodynamic ensemble
Free energy: -120.06 kcal/mol
Frequency: 0.0000
Diversity: 186.05
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((((((...((((((......((((.((((..((((.......))))...)))).)))).......))))))....(.(((((((.......((((((((((((.....)))))...))))))).......))))))).)..(((((((.............)))))))..(((.((.........)).)))..((((......))))(((((((((.(((...(((((.((((((.......)))))))))))((((((..(((......)))))))))..........))).)))))))))................((((((.(((.......))).))))))..(((((((..(..((((......))))..)..))))))))))))))))...........(((((((.....)))))))...((((.(((((...((((.(((.((....)).)))(((((((.....)))))))...............))))...)))))))))(((((....)))))
Thermodynamic Ensemble Prediction
....(((((({.,,,{..((((.,,..||||.,{{{|||,||}}...,,||||...}||)|))||.......|||}|||,,.{,{{(((((...,,,.{{((((((((((.....))))}..}))))))),,.....)))}}}}|}}.(((((((.............)))))))..{((.{{,,,,..,,,|},|}|{{((((......})))||{(({{{{,(((.,{(((({|{(((((.,.....}))))})})))||,{{,..{{{..,...|||,||||,,,|||,,,,.}}},|})))}}}}.{{{{...........((((({.(((.......))).})))))}))}||,,|,.,.}||||}}},}})},,.}}}})}||}))}}}}}||{{....,},....(((((((.....)))))))...,,,{{{.......|||,,||{,||....,.{|||,,|,,,{{{.,{|,||,.,}}))}.}}}......)))).....,})))))(((((....)))))

Transcripts

ID Sequence Length GC content
AUCUCUUGAGACUUCACUUCAGCUUCACUGACUUCUGGAUUCUCCUCUU… 532 nt 0.3571
Summary

This gene encodes a member of the histatin family of small, histidine-rich, cationic proteins. They function as antimicrobial peptides and are important components of the innate immune system. Histatin s are found in saliva and exhibit antibacterial, antifungal activities and function in wound healing. [provided by RefSeq, Sep 2014]

Forensic Context

A study in humans demonstrated that a one-tube, two-step isothermal amplification assay (RT-RPA followed by LAMP) for the HTN3 mRNA enabled rapid, sensitive (0.5 µL saliva, 100 fg RNA), and specific screening of saliva in forensic samples, successfully detecting it in mixtures and most mock forensic samples [Kubo et al. DOI:10.1016/j.forsciint.2023.111847]. Another human study found that primers targeting transcript stable regions (StaRs) for the HTN3 provided vastly improved and consistent detection in degraded buccal/saliva samples compared to conventional primers, which often failed [Lin et al. DOI:10.1016/j.fsigen.2015.09.012]. A study in human body fluid stains demonstrated that the co-extraction method successfully isolated high-quality RNA and DNA from saliva, with the HTN3 mRNA and DNA detectable from the lowest tested volume of 1.6 µl for forensic body fluid identification [Alvarez et al. DOI:10.1016/j.ab.2004.09.002].