Basic Information

Symbol
HTR1A
RNA class
mRNA
Alias
5-Hydroxytryptamine Receptor 1A 5-HT1A ADRB2RL1 ADRBRL1 5-Hydroxytryptamine (Serotonin) Receptor 1A, G Protein-Coupled 5-HT-1A G-21 Guanine Nucleotide-Binding Regulatory Protein-Coupled Receptor 5-Hydroxytryptamine (Serotonin) Receptor 1A Serotonin Receptor 1A 5-HT1a Receptor 5HT1a PFMCD
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry evaluation Other applications

MANE select

Transcript ID
NM_000524.4
Sequence length
4572.0 nt
GC content
0.5195

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1677.90 kcal/mol
Thermodynamic ensemble
Free energy: -1759.74 kcal/mol
Frequency: 0.0000
Diversity: 1287.20
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...........((((.....(((((.....((((((((.(((((((((((((.(.((((..(((((((((((((....))))((((((((((..((((.(((((((((((((.((((.((((((.((.(((..(.((((...)))).))))...((((((.....(((((((((((.((((((((((((((.....(((((...(((((((((((((..((((.((((..(((.(((((((((((((((..((((.((.(((((((.(((.((((....(((....(((((((((((((((((...))))))((((.(((((((((.....(((((((((....)))))))))(((..((((..(((.((((((((.......))))((((((((((..(((((((.(((.((...((((.((((.((..((..((((((((((.........(((((((((((((...(((((.((((((((((....(((((((....)))))))((((((....((.((.(....).)).))...)))))))))))))))).)))))(((((((((((....(((.((((((.((....)).))))))((((((((((....(((((.(((...........)))))))))))).))))))...(((((((((.((((.(((.....((...))......))))))))))))))))((((.....)))).)))...((((((....(((((....)))))........)))))).((.(((((((.....))).)))).))..........)))))))))))((((.(((.((((....................)))).))).))))...)))))))).)))))))))))....))))..)).)).)))))))).)).)))...))))))).((.(((...(((((((......))))))).))).))((((...))))(((((..(((((((..(((.(((...(((((((((((......)))))....((((((((....(((((((((........)))))......))))..((.((((......)))).)).)))).)))).((((((((((....))))...))))))....))))))..)))))).)))))))..)))))...((((((((((((((.(((.(((((((.((((((.(((((((..(((.((((((..............((.(((((...))))).)).(((((((...((.((((((((...)))).)).(((.......))).((((..((....))..))))..((((....))))(((((((((.(((.(((.((((((...((((((((((((..((((...(((.(.((((((((....)))..(((.....))).......((((((((...(((..((((....))))..)))....))).)))))..))))).)..)))..))))..)))))))))))).)))))).).......)).))).)))))))))..)))).))))))).......)))))))))..))))).)).)))))))).))))).))).)))).))))...(((((((.(((.(((((((((((....)))...)))))..(((((((((..((((.((((....((((.(((...(((((((((.....)))......((((..(((....)))..)))).))).)))...))).))))..))))...)))).....))))))))).)).).))))))))))..))))))))))))))))..........(((((..(((((((((......)).)))))))..)))))..(((((......))))).))))..((.(((((((((.(((((((................((((((((.......(((......(((((((.....((((..((((........)))))))))))))))......))))))))))).)))))))))))))))).))))).))))..))))))))))))....((.(((((.........))))).))........((....)).))))..))))))))))).(((((.(((....)))...))))))))..)))))))))).)))))).))))..(((((((((((((....))))).).))).((((((((((.......((...(.((((((...)))))).).....)).......))))...))))))(((.((((.......))))..)))....))))))))))))).))).))))))........(((((((..((((..(((((......)))))..))))................((((....)))))))))))((((......)))).....((((..((((((.(((........))).))).))).))))..)))))))).)))).)))).)))))..)))))......))).))))))))))).))))))..)))))....)))))).)).)))))).)))))))))).))).)))).))))......((((((((..((((((((((......))))))))))....))))))))...))))(((....)))((((......))))..((((.....))))..((((...))))))))))..)))))))))...(((((((((.((((((((((.(((((((....)))))))......(((((....))))).(((..((((.(((.((((((((..(((((((((((..((((((......)))..)))..)))).((((((.((.(((.(((.......(((...))).....))).))).)).))))))((((...(((((((.((((((.(((..........)))))))))))...((((((.(((((.(((.((((((((((.....(((((((((((((.((..(((((((((...))).).)))))(((((...((((((.((..(((((((((...)))).....))))).))..))))))..)))))((((((.(((....(((((.(((((((((((((.(((((....)))))((((....))))...((.((((((.....))))))))...((((((..((...))..))))))..)))))...)))))).).).)))))..)))...)))))))).)))))))))))))))).)))...))))...)).).))))).)))))).)))))...))))((((((((.........))))))))..)))))))..))...)))))).)))...))))..)))((((...))))...(((((.((......)).)))))))))))))))...((....)).....((((((((.....)))))))).((((.....)))).(((((((.(((....))).))))))).)))))).)))((((.(((((((((........))))))))))))).((((..(((((....))))).))))...(((((((...((((((((....((((((....)))))).....))))))))...))))))).((((((((((((((...(((((((.....)))))))))))))....)))))))))))).).)))))))))))))))))((((((...((((((.((((((.((((......))))....((((..(((.(((......))).))).....))))....(((((((..(((((((.(.....).)))))))...((((((.((((.....))))..))))))(((((..(((.(((((..(((.........)))....)))))..))).)))))....(((.((((.(((.((((((.(((((((((((.....((((((((.((.(((((..((.(.(((.......))).).))...))))).)).))))))))..((((((.((((....)))).))))))(((((.((((.((((((((((...((......))....))).)))).))).)))).)))))((((((((((((((((.......)).))))))))))))))..((((((((((((.......).)))))....))))))((((.....))))((((.....))))...)))))))..))))))))))))).))))))).(((((((..................((((....))))....(((((((.....(((.(((((....((((((((((((((.......)))))).)))).............((((((((((((((......................(((((((((...((((........))))..))))))))).......((((((....))))))...........(((..(((((......)))))....)))...))))).)))))))))..))))))))).))).....))))))))))))))..)))))))...))))......)).))))))....))))))..............))))))))).))))....
Thermodynamic Ensemble Prediction
,.,((((((((((((((.(((((((.,,,,((({({{{,(((((((((((((({((((((((.(((((..,......})))),))|{(((((..((({.((((((((((((({((((.((((((,({,(((,,(,({{{...,}||,|}}}.,,((((({.{{,.{((((((((((.((((((((((((((.....(((((...(((((((((((((.,((({.{(({.{(((.((({((((((((((((.((((.(({(((((((((((,((((,{..{((...,{((({((((({((((((...))))))((((.(((((((((.,,,{(((((((((....)))))))))|||,,((((..(((.{((((,((.(.(((((.{{((({{((({{{{(((((((.(,{{(....{(((.((((.{(..{(..(((({{{{((,..,.,.,{{{{{{{(((({{{...(((((.((((((((((...{(((((({....}))))))|{{{{{,...{(.((,{...,}.,}.)}.}})})})})))))))))).))))){((({(({{{{..,,{||,{(((((.,,....,}.)))))}((((((((({...,((((,{(((...........)))))))))))),,)))))...(((((((((.((((.(((.....((...))......))))))))))))))))((((...|,||||,|||,,{({((((,,,.(((((....}))))........}},,,,.((.(((((((.....))).)))).))...,,,,..,||||}||}}||(({{.{||,|||{,,,,,||}|......,,.,}))))|)))|))))..,})}})))).))))))))))),...))))..)),)).)))))))).}},})},.,))))))),||.}},},.(((((((......))))))),..||||(({(,||}||},,.})))))))).))))).))),)))}}|||.}|}||,.....(((((((((((.((((.{,.,((((((((......((.|,|{{,.,.((({{{(((.{((,.(((((((((((((.{((.(((((.((((((((((....))))...))))))...(((((.....)).)))||,{,....}}}},.)))))))}((((((((,(((,(({{{((.((((((.(((((((..(({,{{{(((..,,..........,{.(((({...})))).||,((((((({{.,,.||((((((...)))).)).{((.......}}}.((((..((....))..))))..((((....))))(((((((((.(((.(((.((((((...((((((((((((..((((.,.(((.{.(((((({({...|}}..(({.....))).......((((((((.,.(((..((((....))))..)))..,.))))))))).}))))).,..)))..))))..)))))))))))).)))))).,......,)).))).)))))))))..,))),)))))))..,},|,)))))))))..)))))}}).)))))))).))))),))),}})).))))...)))))))..((.(.(((((,{......,{(.(((.(((((.((...}}))))).))).)).......|)))))}}}(((((....))))).......}))))),)),)))))))).)}))}.).,,)}))))))))},|,(((((({.(((((....))))){{{{{{{.{{.(((,|,,...,.))}.)).})).))))))))))).)}(((((..(((((((((......)).)))))))..))))).,}.))))..)))))))))))....{(.((((((({(((((((((..,.....}.......((((((({.,,,,..{{{......(((((((.....{{((.,{{{{,....,,.}}}})))))))))))...,..,)))))))))).)))))))))))))))).)}))).))))..})}))))))))).}},}|}|||||,....,,,.|}}||,,.........|,...,)).)}.)}})))))))))))}|||,|}||,{{{{|||{{{,|,|||||{{,,},|||,,,.|,,,,|(((((.(.((.(((((((((....))))).).))).)).).)))))},.}}},}.}}}}}....||.,.}))}}}}))})..{{{{.{{{{|,||{||,...,,{{{...,..}}},}})))..})))}..}))))))))))))))))).)))))}...,,,..(((((((..((((..(((((......)))))..))))................((((....)))))))))))((((......)))).....((((..((((((.(((.,......))).))).))).))))..,})})))).)))).))))})))))..)))))......))).))))))))))).))))))..,}}}},|||||||||.}|,)))))),)))})))))).))}.)))}.}))}.,,...((((((((.{((((((((((......))))))))))..).))))))))...}}}}|{{...,)))|||(,,,.,,||}}..((((,,,,,|,||||{|({{{{|{{{|,|||(((({||({||{..,({{{{||{{,||||{{||||,(((((((....)))))))..,,.}|||||.}}.,))))}}|))),,}),)))))||,||||{|||||||||(((,{(((((({.{{{.{|...,{{{.{{{{((((((({(..,({.,,,..},..}||}},......,.{|(,{{{,{{{.,,,))),|}}.}}){{((((.((((((,(((..........))))))))).)}})|(((((.(((((.{((,((({((((((.....(((((((((((((.((..((((({(((...))).).)))))(((((...((((((.,,..(((((((((...)))).....))))).))..))))))..)))))((((((.(((....(((((.(((((((((((((.{((((,,,.|||||{|||.,,,)))),..((.((((({.....})))))))..,((((((..({...})..)))))).,)))))...)))))).).).))))),.)))...)))))))).)))))))))))))))).))}...))))...)),),))))).)))))}..{{({..{{(({((.,.((({.....)}}}{{{{{{{.{{(({(|,.,,,...,,....||{{...,}))}}.))))}}.}}))))}..{((((.((......)).))))),,.))))))).))))...........((((((((.....)))))))).{(((.....)))}.(((((((.(((....))).)))))))..,,))}.)))}.}}}(((((((((........)))))))))....{(((({{(((((....))))).,}}},,,{((((((...((((((((....((((((....)))))).....)))))))).,.))))))}))|||||||,|||||}}}|||,{,,,}.}})))))))))))))..,,))))}}||..))|}|)}}}})}}}}}}},,,,,||||,,,})}}}}|)|.}|}))||||}},...,))),,...}},,,})},)||,)},.{{{{{{{{(((((,({...{|((((,,...{{,,(((....{{{|{,||||||...((((((.((((.....))))..)))))).,|||}|||}}||{,,..|||...,,,,.,))))}..,}}}.,.}})})))),.})))).)))))))))))))}|)))|||,,,,{{{,,,..((((((((.((.((((({.,(.{.(((.......))).).)}.}}))))).)).)))))))).,((((((.{(((....)))}.)))))){((((.((((.((((((((((,,.((......))....))})))))},)).)))).))))}((((((((((((((({.......}}.))))))))))))))..((((,{,,,,,,.}}}},{|{|.,,},,}})}||||{{{{,,,||}}.}|||{.....,|||{{{||||||{{{|},,|,.,,,,,,..})})}},)))})}})))}..,}||||,,,},..})},,}})))))))).)))))).)}},....((((((((((((((((.((((((.......)))))))))).........{{,,,{(({......|||...,}}},,,,.............,,,(((((...((((........))))..)))))))))))).))))}..{(((((((..|.((.{((((({{.(((((.,,...{((((.(((((((,.(({(((((..,,({(((((({..{{{{{,..........))))...),,))))))))))))),..}))),,..,}))))),.))))}...,.....})))}.,,,)}}))).)).)..))))))}.

Transcripts

ID Sequence Length GC content
GUUGACAAAAAGAGACUCGAAUGCAAAGACGCUGAGCUAGAGGGAGAGG… 4572 nt 0.5195
Summary

This gene encodes a G protein-coupled receptor for 5-hydroxytryptamine (serotonin), and belongs to the 5-hydroxytryptamine receptor subfamily. Serotonin has been implicated in a number of physiologic processes and pathologic conditions. Inactivation of this gene in mice results in behavior consistent with an increased anxiety and stress response. Mutation in the promoter of this gene has been associated with menstrual cycle-dependent periodic fevers. [provided by RefSeq, Jun 2012]

Forensic Context

A study in mice demonstrated that the HTR1A is expressed in pancreatic beta cells and is implicated upstream of the transcription factor Pet1/Fev in inducing insulin expression [Korchynska et al. DOI:10.15252/embj.2018100882]. A literature synthesis examining human and rodent studies found that trauma-induced alterations in the HTR1A expression are dependent on trauma type and extent of exposure, affecting its mRNA and protein levels in a region-specific manner in the brain [Lewis et al. DOI:10.1038/s41398-020-00915-1].