| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCACAGCAGCAAGCAAGUCUAGUGAACAGAUAAGAUGACAUGCUCAG… | 2170 nt | 0.3949 | |
| AGUCACAGCAGCAAGCAAGUCUAGUGAACAGAUAAGAUGACAUGCUCAG… | 1787 nt | 0.4007 |
This gene encodes one of the several different receptors for 5-hydroxytryptamine (serotonin) that belongs to the G-protein coupled receptor 1 family. Serotonin is a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. Serotonin receptors mediate many of the central and peripheral physiologic functions of serotonin, including regulation of cardiovascular functions and impulsive behavior. Population and family-based analyses of a minor allele (glutamine-to-stop substitution, designated Q20*) which blocks expression of this protein, and knockout studies in mice, suggest a role for this gene in impulsivity. However, other factors, such as elevated testosterone levels, may also be involved. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]
A study in mice demonstrated that prenatal exposure to psychostimulants like amphetamine permanently impairs glucose homeostasis in adult female offspring by reducing insulin production in pancreatic beta cells, linking this effect to disrupted serotonin signaling and sex-specific epigenetic reprogramming of serotonin-related gene networks [Korchynska et al. DOI:10.15252/embj.2018100882].