| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAUGAGCGCGCGCCGCGUCCGGGGCCGGCUGGUGCGCGAGACGCCGCCG… | 4465 nt | 0.5510 | |
| AAUGAGCGCGCGCCGCGUCCGGGGCCGGCUGGUGCGCGAGACGCCGCCG… | 4601 nt | 0.5540 | |
| AAUGAGCGCGCGCCGCGUCCGGGGCCGGCUGGUGCGCGAGACGCCGCCG… | 4598 nt | 0.5539 |
The protein encoded by this gene belongs to the heat shock protein 70 family. This gene uses alternative transcription start sites. A cis-acting segment found in the 5' UTR is involved in stress-dependent induction, resulting in the accumulation of this protein in the endoplasmic reticulum (ER) under hypoxic conditions. The protein encoded by this gene is thought to play an important role in protein folding and secretion in the ER. Since suppression of the protein is associated with accelerated apoptosis, it is also suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness. This gene also has an alternative translation initiation site, resulting in a protein that lacks the N-terminal signal peptide. This signal peptide-lacking protein, which is only 3 amino acids shorter than the mature protein in the ER, is thought to have a housekeeping function in the cytosol. In rat, this protein localizes to both the ER by a carboxy-terminal peptide sequence and to mitochondria by an amino-terminal targeting signal. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
A study in human skin wounds demonstrated that the HYOU1 is expressed by macrophages and myofibroblasts during granulation tissue formation, with its immunohistochemical detection ratio increasing to a peak in wounds aged 7–14 days, where a positive ratio exceeding 50% strongly indicates this wound age range [Ishida et al. DOI:10.1007/S00414-008-0255-1]. Furthermore, a review of forensic molecular pathology indicates the HYOU1 is also applicable as a marker for estimating the duration until death, with its expression in the human brain being related to survival time [Maeda et al. DOI:10.1016/J.Forsciint.2010.07.024]. Morphometrical analysis established that an HYOU1-positive ratio exceeding 50% strongly indicates a wound age of 7 to 14 days, while a ratio greater than 40% suggests a wound age of 7 days or more [Kondo et al. DOI:10.1016/J.Forsciint.2010.07.004].