Basic Information

Symbol
IARS1
RNA class
mRNA
Alias
Isoleucyl-TRNA Synthetase 1 ILRS IARS Isoleucine TRNA Ligase 1, Cytoplasmic Isoleucine--TRNA Ligase, Cytoplasmic Isoleucyl-TRNA Synthetase EC 6.1.1.5 IRS EC 6.1.1 PRO0785 GRIDHH ILERS IleRS
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002161.6
Sequence length
4483.0 nt
GC content
0.4334

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1292.20 kcal/mol
Thermodynamic ensemble
Free energy: -1376.16 kcal/mol
Frequency: 0.0000
Diversity: 1058.51
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((.......)).)).)))((((((.(((.((((((((((((((.(((((((((((.(((((((((...((((.((.((((((......)))).......(((((.(((((((((((((((((.(((....((((.....))))..)))...)))..)))))))..))))))).)))))(((...)))................................)).)).))))....)))..)))))).)))))..((((....))))...)))))).(((((((((((((((((.((......((((((((((.(((.(((((((.........(((((((((..((((.((((((((..(((.(((....(((....................))).....))).)))....)))))...))).))))(((((((.......(((.(((.((((((((............((((((((((((....)))))..)))))))...........))))).))).).)).))).......)))))))))))).)))))))))))))).))))))))))((((......((((((((..((....))..))))))))(((.((..((((((((.........))))))..))..))))).((((((....((((.(((....(((..(((((((.......)))))).)..)))))).)))).....)))))))))).)).)))))))))))))))))..(((....)))....(((((..((((.(((((....))))).))).)....)))))....(((((((.(.........).)))))))..(((........))).......(((((.(((((((((((.(.(((((.....))))).)))))((((.(((...(((..(((((((((((((((.......))))).(((((((((((....)))))..))))))((((.((((.....((((.((((((((((((((.((.((.(((....))).)).))....(((((.(((((....(((((((.((.(((((((......).))))))))....(((((((((((...............(((.........)))((((((..((((..((((((((((..(.(((((((((....((((......))))......)).))))))).)..))))....))))))..)))).(((((......)))))((..(((((((..(((.....((((((((..(((..........)))((((........)))).......((((((.((((.....)))).)))))).))))))))..((((((((((((((((....((......(((((........))))))).))))))))..........(((((....)))))((........))..((..(((((.....)))))..))......(((((...)))))..))))))))(((((....)))))...(((((((((((.((((((((((((((((((.((((......((((..(((.....((((...)))))))))))...)))).))).))).))))))..........((((((((((((((((...((((((.((.((((..(((...(((((..((((((..((.((((...)))))).(((((((((.((((((((.((((....)))).))(((((((((((......)))).)))))))..(((((((((((...(.(((.((((((((.((......)).))).)))))..))).)...))))))...((((((..((((((((.((......)).)))).)))))))))).))))))))))))))......))))))..................))))))))))).....))).)))).)).)))))).))).))))(((((...)))))....((.(((((......(((((.((.....)).))))).....)).))).))((((.((((((....)))))).))))))))))))).)))))).)))))))))))....((((....)))).))).)))))))..))...))))))...(((((......)))))...((((......)))))))....)))))))))))))))))))))))))...(((((((..............)))))))....((((.(..((((........))))).))))..((((((((((.(((((...(((((((((..........)))))))))....)))))........(((((...(((((.((((..(((((((((((((((((((.......)))))((((((((((.(((.((((...((((.((((((((.(((((((((.....(((...........))).....))))))).))(((((((((((((((..((((..(((((((((...((((((..........))))))....))))))........))).))))..)).)))))).).)).))))...((((((((.((((.(((((..((((....))))))))).))))..........(((((.........((((((...((..((((((....))).)))..))......((((.((((((.....))))))))))........(((((((...))))))).(((((..((((.(((.................))).)))).))))).))))))(((.((((.......)))).))))))))))))))))))))))))..))))((..(((((.....))))).))......)))).))))))).))))))(((((((....)))))))(((....)))...)))))))....))))))).......)))).)))))...))))))))))))))))))).))))))..)))).)))).....))))))))..((.((..((((.(((..((..(((((((....))))..)))...))..))).))))..)))))))))))))).)))))).))))..........(((.....)))))))))))))))((((.((....)))))).........))).)))))))))))))).))))))....((.(((.((((((((((.(((((((..(((........)))..)))))....(((((........)))))((((((((((...((((.................(((..((((((((((...((((............)))).)))...)))))))))).(((((((((((((.((((........)))).))))))...))))).)).......(((((...))))).((((((((((...((((.((..((((...))))......(((((((((((....))))((((((((((..((.....((.((((((((.((((.(((......)))))))..............((((((.....((((.((((.......((((...))))(((((...((((((........))))))..))))))))).))))......))))))...........))))).))).)).....))..))))))))))....(((((..(((((...(((.((((((((........))))))))...)))....)))))....((((((((((........((...((((((((..((((...((((((((....)))..)))))..))))..)))))))).))....)))))))))).)))))(((((((((((......))))((((((...(((((...(((((........((.((((..((((((..........))))))...)))).))......(((((((..(((((........((..((.(((((((...((((((((.......((((((.......))))))))))))))....)))).))).))...))........)))))..)))))))....)))))..)))))..))))))..)))))))...((((((..(.(.((((.(((....))))))).))))))))........))))))).....(((((((((.((.(..(((.(((((((((.(((((.((((((((((.((.(((......))).)).)))).))))))..)))))......))))))))).)))..))))))))))))..............)).)))))))))))))).)))).))))))))))(((((((((((((((....(((((((.........(((.((........)).)))............))))......)))...)))))))))))))))........(((((..........)))))))))))))).))).))).))..((((..(((..............))).))))...
Thermodynamic Ensemble Prediction
..(((((((.,.....)).)).)))((((((.(((.((((((((((((((.(((((((((((,((((({{{{.{.((((,{{.{((({{......||||,......(((((.(((((((((((((((((.(((...,((({.....))))..)))...)))..)))))))..))))))).))))),,|..}))))...................,,,........})}.)),}}}},...))}..)))))}.)))))..,,||,,,,,}},,.,)))))).(((((((((((((((((.({.,,...((((((((((.({{{(((((((.,,.({{,.,.||||.((((,,,,.||||((((,,(((.(((....{{{..,,.........,|,,...))),....))).))).,..)))),...||,{{{||(((((((....,,,(({.{(({((({{{{{.....,.,....((((((((((((....))))}.,)))))))}))},},.,,.))))).)}},).}}.}}}.......))))))))))).)},..)))))))))).)))))))))),{||...,..((((((((..(,....)),.)))))))){{{|{{..{{((((((.........))))))..,}.,,},,}{{(((({....((((.{{{...{{{{..,((((((.......)))))).,,.}))))).)))).....})))))),,,.}).)))))))))))))))))..{((....}}}....(((((..,(((,(((((....))))).)}),)....)))))....(((((((.(.........).)))))))..(((........))).......((({{{(((((((((({,(.(((((.....))))).)))}}((((.(({..,(((..((((((((((,((({.,,,,..,}|||.{{((.(((((((((((({{..((.((((((,,{((({.....,{,,{((((,,,,,{,|||}|{.||.,|,,.,,}}}.,)))))).}}..}}.))))))),.{((((((.((,{(({{{{...,,.),)}|}}}}|.,,.(((((((((((..,...........,{{{..,......}}}((({{{,,((((,,(({(((({{{..{,(((({{{{{|,.,{|||.,,..,}))),...,.}}.))))))),|,{||},....))))))..}}}}.(((((......)))))((..(((((((..(((.,,,,({{{{(((.((((..........)))||||........||||.{{....((((((.((((.....)))).)))))).}))}))))..{{{|||||((((((((....((......((((({......,))))))).))))))))..........|,.(((((((((((,(,.......,,..,,..,|||.}}}}})))))}.,,.,....(((((...)))))..}}}))))}(((((....))))),..(((((((((((.((((((((((((((((((.((((......((((..((({....{{{{...}}}))))))))...)))).))).)))}})))))..........(((((((((,((((((...((((((.((.((((..(((...(((((..((((((.{({.((({...})))}}.(((((((({{((((((((.((((....)))).))(((((((((((......)))).))))))),.(((((((((((...{.(((.((((((((.,(,,....,),))).)))))..))).,...))))))...((((((..((((((((.{{......}).)))).)))))))))).))))))))))))))......))))))...,,...........}}))))))))))).....)}).)))).)).)))))).))).)))|(((((...)))))}...((.{((((.,....(((((.((.....)).))))).....),}))).))((((.{(((((....)))))}.))))))))))))).)))))).)))))))))))....{{{{....)))).))).))))))),.))....,,,,}..,(((((,,,..,|}}},,,.,|||}}}},,},,}}}}....))))))))))))))))))}}|}}||,|||{(((({,{,,{((({{{{..{{(|(({,...{((|,{||{{{{........}}|||||}}|,,((((((((,..(((((.,.(((((((((,....,,...)))))))))..}.))))}.(((({(((((((...(((((.((((..((((((((((((((((({(.......}}}}}((((((((((((((.((((.,,(({{.((((((((.{{(((((((.....(((.......,...))).....})))))),||((({{({(((((((({,((((..{,,((((((...((((((..........))))))....))))))........))).}}))}.))))))))).).)).))))...((((((((.((((.(((((..((((....))))))))).))))..........(((((.....,...,{{{{{...((..((((((....))).}))..)).....,((({{((((((.....))))))))))..,,....(((((((...))))))).|{{{{..((({.{((((,,..........,,.,)).}))).})))}}},,}}}(((.((((.......)))).)))))))}))))))))))))))))..}}}}((..(((((.....))))).)),,,}..)))).))))))).)))))){((((((....))))))|(({....}))}..))))))),...})))))).....,.)))).)))))...))))))))))),))))),,))})))}|||}{{,,{((({.,....,)))))))).|||,,|||}|||.}|..,}},{{{{..,,))}|,|}}},,))).,})),})))).,))))))))))))).)))))).)))).....,,,|.{{,...,,)))))))))))))))((((.((....)))))).........)))}}))))))))))))).))))))...,((,({{,{{,.{{{{{{.,.,,{({.{{,...((((((({.((((...))))(((((........)))))((((((((((...((((.................{{{..((((((((((...((((............)))).)))...)))))))||},(((((((((((((.((((........)))).))))))...))))).)}.}..,..(((((...))))).((((((((((,,(((((.({..,{{|,..)))),}....((((((((((((({{,|({(((,,,,,||{{{{,....}}}||||||||}((((.(((......))}))))..............{{((((.....((({|..(({{......|||}..}}}}{((((...((((((........))))))..)))))}}}}.)))}......)))))).....{{(({...(((((({,,{{,,..{{..,,{(,(({(((({.(((((..(((((...(((.((((((((........))))))))...)))....)))))....((((((((((........((...((((((((.,(((({{{(((,,,,,.....)))})))))},,)})..)))))))).))....)))))))))).))))){((((({{{{{......||}}((((((.,.(((((.,.(((((..,,,,,,((.({({..{(((((,.........})))))...)))}.))..,...(((((((..(((((........,,..((.(((((((...(((((({{.....,.((((((.......))))))))))))))....)))).))).))..,}}.....,..)))))..)))))))..,,)}}})..))))).,))))))..)))))))........}}}}}}}}}}.,)|,.,},),)))))))))))))}}}}},}}.))))))).,,,.{((((((((,,(,(,,(({.{{|||||||.|||||,||||{|||{,.,,.,(({{,.,,|||,||.||||||}}}}|,.}||||,,....}}))))))).)})..))}))))))}}}.,,..,,}}}},..)),))}})))))))))).)))).))))))))))(((((((((((((((....(((,{{,.........,{(.((.,,.....}),))){,..,,..,,,.}}}}......)))...)))))))))))))))........,((((..........)))))))))))).,.,},..}},},.)))),}}.,,...,,,,,...,,............

Transcripts

ID Sequence Length GC content
GUGCGCCCGGUUGCAGCGUGGACGCCGGAUGAGUUGCUUUUAGGCUUGC… 4653 nt 0.4361
Showing 21 to 21 of 21 entries
Summary

Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Isoleucine-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family and has been identified as a target of autoantibodies in the autoimmune disease polymyositis/dermatomyositis. Alternatively spliced transcript variants have been found. [provided by RefSeq, Nov 2012]

Forensic Context

A study in the blowfly *Calliphora stygia* identified 22 candidate ionotropic receptors (IRs) in adult antennae, including co-receptors IR8a, IR25a, and IR76b, and representatives from 10 of 13 conserved antennal IR groups [Leitch et al. DOI: 10.1186/s12864-015-1466-8]. A study in the blowfly *Calliphora stygia* identified 22 candidate ionotropic receptors (IRs) in the antennal transcriptome, including co-receptors IR8a, IR25a, and IR76b, and representatives from 10 of 13 conserved antennal IR groups [Leitch et al. DOI:10.1186/s12864-015-1466-8].