Basic Information

Symbol
ICAM1
RNA class
mRNA
Alias
Intercellular Adhesion Molecule 1 CD54 BB2 Major Group Rhinovirus Receptor ICAM-1 Intercellular Adhesion Molecule 1 (CD54), Human Rhinovirus Receptor Epididymis Secretory Sperm Binding Protein Cell Surface Glycoprotein P3.58 Human Rhinovirus Receptor CD54 Antigen P3.58
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Mechanical injury analysis

MANE select

Transcript ID
NM_000201.3
Sequence length
2967.0 nt
GC content
0.5605

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1140.70 kcal/mol
Thermodynamic ensemble
Free energy: -1189.84 kcal/mol
Frequency: 0.0000
Diversity: 702.40
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((..(((((.....)))))..))......(((((....((((.((((((((((((..((((.(((.((((((..((((((((((.(((((((.....((((((.(((((((((....((.((((...(((((((.((((...((.......(.(((((((.((((((((((((........))))))((((((((.(((((((((....))))))...........((((((((...(((((...)))))...))))..)))).(((((((.......(((.(((...))).....((((((((.....)).))))))...(((((((....)))))))...))).....)))))))(((((.(((.((((...)))).))))))))...))))))((((((...(((((((((....(((.(((...))).)))...))))))))).))))))...((((((.(((..........))).)))))).((((....)))).)))))........))))))((.((((((((((..((((((((((.((....((((((.(((.(.(((((((.............))))))).))))))))))...)))))))((((...(((((((((((((((.(((((.....)))))........))))))))).))))))..))))))))).)))))))))).)).......))))))).))).)))).)))))))..((((((...(((((((((...))))))))))))))).)))).))..).)))))))).(((((((((((((.......((((((((((((..(((((((.((((..........(((.((....(((((((.(((.(((.(((.(((((.(((.((((.((....(((((((((.((((((....((((..........)))).....)))))).)).)).........)))))....)).))))..)))..)))))...........((((((....))))))..))).))).)))....)))))))...)).))))))))))))))......))))))).)))))......(((((((....)))))))...((((((..(((((((((((.((....((((.((((......))))))))...)))))).)))))))(((((...............((((.((((((..((((.(((((.((.(((...))))).))))).)))).....))))))...))))...)))))..........)))))).)))))..)))))))).....))))))......)))))))..(((((((........)))))))......(((((.((((((..(((((((...))))).))..)))))))))))............)))))))))).......((((((((((((.....)))))))............)))))..(((((((.....)))).)))((((((((....)))))))).....)))))).))).))))...((((((((........(((....)))..........................(((((.....))).)).............(((((((.(((((((..(((((..((......))..)))))..(((((((((((((.........(((((((..(((((((((((......)))).........(((...)))............((((((((....)))((((((((....))))))))...(((((........)))))))))).)))))))))).)))).........)))))..............(((((....)))))......)))))))).((.(((((...(((((.........)))))..))))).))..((((((.(((((((.(((((((.........)))))))((((((.(.....((((((.(((.(((((.((((..(((..(((((((((..((((..((((...(((....)))..)))).))))))))....(((((.........))))).(((((((..(((((....)))....))..))))).))...(((....)))))))).....(((((((.((........)).)))))))(((((((...(((((..((((.(((((.(((((((...........((((...(((((....((((.(((((((((((.......((.......((((((((..((.(.(((........))).).))..))))))))......)).....))))))))))))))).....)))))))))))))......(((((((....)))))))....))).)))))))))..)))))))))))).)))..)))))))))..))).))))))...)))))))......)))))))......((((((....))))))((.(((((((((......((((..((((.((((((......))))))..))))..))))..(((((.(((.(..(((((.(((.((....))))).))))).)))).)))))((((((((....(((((.((((.(((...)))))))))))).(((((.......)))))...)))))))))))))).))))).(((((((...(((((....)))))..)))))))....)))))).))))).)).))))))))))))))).(((((((....))).))))....((((.(((.((((((((..((....))..)))))))).))).).)))...)))))...(((.......)))(((((....)))))..))))))))))))))))...............((((...((((...............(((((..(((((((.(((....)))..)))))))))))).(..((((.....))))..))))).))))
Thermodynamic Ensemble Prediction
(((({{(({,({{{{{|||,|{{|,.,,,{{((({,,,{,,((({((((,{(((({(..((((,({(.(((((({{((((({{{{{.(({((((({,,{(((((({(((,{((({..,,{{,{{,{...,(({((({({,,...{(.....||,.,,,||||,||||,.({((((,...,...)}})}},|||||||,,||(({{{{....))))))}}})}}.,,}}},|))|,....|||||..,)}}}|,||,||},.,..},(((((((.......(({.(({...})).....((((((((.....)).))))))...(((((((....)))))))...}}}.....))))))){((((.(((.((((...)))).)))))))}....}}||{((((((,,.(((((((((..{{(((.(((...))).))).}}))))))))).)))))).)))|||{|.|||}},...,,,.|}|.|}}}}..|{||}}}}))}}..)),))}}....|))))}}|{.{||(((({{{..|||||||||{.||,,..{((({{.((({,,((({((({,{....{,{,{.}}}||||,|||||}}}}}...|||||||({((,,.(((((((((((((((.{{(((.....)))||........))))))))).)))))}.,|}}}}}|||,|}}}}}}}}}.,,.},..}}|}}}))}}|,,.}}))|)))},}},{((((((.,.{{{|{||||,},)}}}|||||},}}}),)))}.)),})))))))))),(((((((({((((,....{.((((((((((((({(((((((.((((..........(((.((....(((((((.(((.(((.(((,(((((.(((.((((.((....(((((((((.((((((....((((..........)))).....)))))).)).)).........)))))....)).))))..)))..))))).,.........((((((....))))))..))).))).)))....)))))))...)).)))))))))))))}.,))..)))))))}}))))}.,...(((((((....)))))))...((((((..(((((((((((.((....((((.((((......))))))))...)))))).)))))))(((((.,{,......,,,..((((.((((((..((((.(((((.((.(((...))))).))))).)))).....))))))...))))...)))))........,.)))))).))))}..)))))))){{{{{|}||,,...,,,))))))|{{(((,((({..{{{{{|||||||{{{{.,,,,,,.,,||||},,,||||.}}})),)).,)}})))))))||||........,}}}))))}}||||{{{....{{{(,(((((((.....))))))).,....}}))}))}})),}}|}||||},...,}}}.||,((((((((....)))))))).....}))))}.}}}.))))...((((((((.,......(((....)))..,.......................(((((.....))).)).............(((((((.(((((((..(((((..((......))..)))))..{((((((((((((.........(((((((..(((((({((((......))))|..{.,,.,{((..,||,,.....,{,.,,((((({((...,))}((((((({....))))))))...(((((.,....,.)))))))))).}))))))))).)))).........))))).......,,..,,.(((((....))))).,.,..)))))))}.((.(((((...(((((.........)))))..))))).))..((((((.((((((({(((((((.........)))))))}{((((,,...,.((((((.(((.(((({{((((..(((...{((((,{{..((((..((((...(({....}}}..)))).))))||||,,||(((((.........))))}.{{(((((..(((((....)))....))..))))).}}..,|||,,..)}}}}}}}.....((((({(,{....,,.,))),,}}}},,((((((({{{(,{{{..((((.(((((.((({(((...........((((...(((((....((((.(((((((((((.......{,..,,,..((((((((..((.(.(((........))).).))..))))))))......}}.....)))))))))))})))}....))))))))))|||{{{,...|||))|,,{{{...,,.}}),))).)))))))))..)))),))))))).)))..)))))))))..))).))))))...,,,}}},,}}}}.)))))))......((((((....))))))((.(((((((((......((((..((((.((((((......))))))..))))..))))..(((((.(((.(..(((((.{((.((....))))}.))))).}))).)))))((((((((....((((((((({{(({...}))))))))))).,((((.,....,))))}...)))))))))))))),,))})}(((((((...(((((....)))))..)))))))....)))))).))))).)).))))))))))))))).(((((((....))).))))....((((.(((.((((((((.,(,....,,,,)))))))).))).).)))...})))),..|||,,,,}}})))|,{{|}}..)))))}})),)))),,,,,})))}............{{((,({{...((.....,|,..,}}.}||}{{,.(((((((.(((....)))..)))))))}}}||}}..,|,....,,)),,..,.,,,.,}},

Transcripts

ID Sequence Length GC content
GAGCUCCUCUGCUACUCAGAGUUGCAACCUCAGCCUCGCUAUGGCUCCC… 2967 nt 0.5605
Summary

This gene encodes a cell surface glycoprotein which is typically expressed on endothelial cells and cells of the immune system. It binds to integrins of type CD11a / CD18, or CD11b / CD18 and is also exploited by Rhinovirus as a receptor. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the ICAM1 (ICAM1) was significantly upregulated in acute myocardial infarction (AMI) patient samples compared to normal controls [Zhuo et al. DOI:10.1186/s12944-019-1142-0]. A study in humans demonstrated that intrapulmonary mRNA expression of the ICAM1 was significantly higher in subacute sharp instrument injury death compared to acute injury deaths and acute cardiac death, although immunostaining showed no significant differences among causes of death [Wang et al. DOI:10.1007/S00414-012-0758-7]. An experimental study in Sprague Dawley rats showed that peripheral thermal injury induced a significant early increase in cerebral mRNA expression of the ICAM1, with levels rising 8.5-fold at 3 hours and 5.3-fold at 7 hours post-injury, alongside a significant 500% increase in serum protein levels at 7 hours [Reyes et al. DOI:10.1016/j.neulet.2006.07.071].