| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCUGAGCCGAGCCCGGUGCCAAGCGCAGCUAGCUCAGCAGGCGGCAG… | 1299 nt | 0.4249 |
The protein encoded by this gene belongs to the inhibitor of DNA binding family, members of which are transcriptional regulators that contain a helix-loop-helix (HLH) domain but not a basic domain. Members of the inhibitor of DNA binding family inhibit the functions of basic helix-loop-helix transcription factors in a dominant-negative manner by suppressing their heterodimerization partners through the HLH domains. This protein may play a role in negatively regulating cell differentiation. A pseudogene of this gene is located on chromosome 3. [provided by RefSeq, Aug 2011]
A study in humans demonstrated that higher mRNA levels of the ID2 in peripheral blood mononuclear cells (PBMCs) from female bipolar disorder patients were significantly associated with lithium non-response, alcohol dependence, and suicide attempts [Voinsky et al. DOI:10.1002/Ddr.21598]. Specifically, expression was higher in lithium non-responders versus responders, in patients with alcohol dependence records versus those without and versus controls, and in patients with suicide attempt records versus controls.