Basic Information

Symbol
ID2
RNA class
mRNA
Alias
Inhibitor Of DNA Binding 2 BHLHb26 Inhibitor Of Differentiation 2 GIG8 Inhibitor Of DNA Binding 2, Dominant Negative Helix-Loop-Helix Protein Class B Basic Helix-Loop-Helix Protein 26 DNA-Binding Protein Inhibitor ID-2 Cell Growth-Inhibiting Gene 8 Inhibitor Of DNA Binding 2, HLH Protein DNA-Binding Protein Inhibitor ID2 Helix-Loop-Helix Protein ID2 BHLHB26 ID2A ID2H
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry evaluation

MANE select

Transcript ID
NM_002166.5
Sequence length
1299.0 nt
GC content
0.4249

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-352.10 kcal/mol
Thermodynamic ensemble
Free energy: -378.46 kcal/mol
Frequency: 0.0000
Diversity: 323.20
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((..(((...((((...)))).))).))))))(((((((((((((((.((((.(((...(((((.((((((((.....((((........((((((((...((.((((....)))))).))))))))((((.((((........)))).))))((((((((((((.....))))).))........)))))..))))...(((((.((..........................)).))))).)))))))))))))))).................((((((((....((..(((.(((((...(((...((.....))...)))))))))))..))..((.((.(((.........))).))))))).)))))...(((((((......)).)).))))))).)))))))).))...((((....(((..((((...(((((....)))))...))))..)))....))))....((((....)))).((((((((((.((..(((((.((((((((.((((.((((.......((.((((((............(((.(((((((((.......(((((.....)))))........((((((.((..(.....)..)).)))))).((((((..................))))))....(((((((.((.((((((...)))))).))..)).))))).)))))).))).)))...((((((.(((((((((...(((.......)))....))))))))).))))))(((((((((((...)))))((((....))))....((((((((..((((.(((......((..((((((((((....))))))))))..))....((....))...(((((((((((.((((.....))))..((((((((((((.....)))))))).))))...)))))))))))...(((((((((....)))))))))....))).))))..))))))))(((((......)))))........))))))((((((((....))))))))........)))))).)).............(((((((((((...))))))))))).((((((...((...(((((.....)))))....))..)))))).)))).)))).)))).))))...)))))...))))))))))))..((((((((((((((((......(((((..............))))).....))))))............))))))))))...)))))...............
Thermodynamic Ensemble Prediction
...((((((..(((...((((...)))).))).))))))((((.((((((((((.((((.({{...(((({,((((((((.....((((,,,,....((((((((...((.((((....)))))).))))))))((((.((((........)))).)))){(((((((((((.....))))).))........)))))..))}),}.{((((.{{..................}|......}}.))))}.)))))))))))))))).,,,...,,.....{..{((({(((.{{{,,..}}},|||,{...{|{,.,{{,....}),,}))}})))}),},|||||((,{,.{{{.........})}..|{{{|,.||.,,...||,,|}|},.,,.})}))}))))))).)))))))).))...((((....(((..((((.,.(((((....)))))...))))..)))....))))....((((....)))).{{((((((((.((..(((((,((((((({.((((.((((.......,{.{(((((...................,{,,{{{{.....(((((,....}}}}}..,|||..((((((.{{,,({{{,.|..}}.}}}}}}.|{{({{,...............,,}}||}},,,..,,,(({{{{{(((,,{,{.||||||......}})))))}.,))))}}))},}}...((((((.(((((((((,,.(((.......))).,},))))))))).)))))).....,(((({...}))))|(((....))),....{(((((((..((((.{{,......((..((((((((((....))))))))))..))..,,({....}}.,.(((((((((((.(({{.....}||,..{(((((((((((.....)))))))).)))}...))))))))))).|,(((((((({....)))))))))..,.))).))))..)))))))}(((((......))))),.,,}}}}.,|}}}((((((((....)))))))),,......)})}}|.||,,........}},(((((((((({...})))))))))).{(({{{........{{{{|.....}}}}}.....,,.)))))).)))).)))).}))).)))).,.)))))...))))))))))}|{{(((,,,((((.,.((((((({,({,{{........,,,,..|||}}.....,}},,},}}}}}},}},}))))))).,.}}}),,,),}}}},...))))..

Transcripts

ID Sequence Length GC content
AUUCUGAGCCGAGCCCGGUGCCAAGCGCAGCUAGCUCAGCAGGCGGCAG… 1299 nt 0.4249
Summary

The protein encoded by this gene belongs to the inhibitor of DNA binding family, members of which are transcriptional regulators that contain a helix-loop-helix (HLH) domain but not a basic domain. Members of the inhibitor of DNA binding family inhibit the functions of basic helix-loop-helix transcription factors in a dominant-negative manner by suppressing their heterodimerization partners through the HLH domains. This protein may play a role in negatively regulating cell differentiation. A pseudogene of this gene is located on chromosome 3. [provided by RefSeq, Aug 2011]

Forensic Context

A study in humans demonstrated that higher mRNA levels of the ID2 in peripheral blood mononuclear cells (PBMCs) from female bipolar disorder patients were significantly associated with lithium non-response, alcohol dependence, and suicide attempts [Voinsky et al. DOI:10.1002/Ddr.21598]. Specifically, expression was higher in lithium non-responders versus responders, in patients with alcohol dependence records versus those without and versus controls, and in patients with suicide attempt records versus controls.