| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGGGGCGUGGAGGGGCGGAGCUCCAGCGGCCUUCAGAGGGGUCGCUAG… | 2313 nt | 0.4198 | |
| CGUGGAGACCUGGAAGGAGGUACCGAUCCAGCCUUGAUUGCAGCCCUCU… | 2470 nt | 0.4227 | |
| GGGUUUCUGCAGAGUCUACUUCAGAAGCGGAGGCACUGGGAGUCCGGUU… | 2318 nt | 0.4185 |
Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the cytoplasm and peroxisomes. It contains the PTS-1 peroxisomal targeting signal sequence. The presence of this enzyme in peroxisomes suggests roles in the regeneration of NADPH for intraperoxisomal reductions, such as the conversion of 2, 4-dienoyl-CoAs to 3-enoyl-CoAs, as well as in peroxisomal reactions that consume 2-oxoglutarate, namely the alpha-hydroxylation of phytanic acid. The cytoplasmic enzyme serves a significant role in cytoplasmic NADPH production. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013] CIViC Summary for IDH1 Gene IDH1 mutations have been observed in a number of cancer types, including sarcomas, hematologic malignancies, colon cancer and brain cancer. Mutations in the two isocitrate dehydrogenase enzymes involved in cytoplasmic (IDH1) and mitochondrial (IDH2) conversion of alpha-ketoglutarate to D-2-hydroxyglutarate have been described as mutually exclusive in many of these cancer types. The most frequent mutations involve R132 (IDH1) and R172 (IDH2) involve the active site and result in neomorphic enzyme activity. The implications of mutations in this gene vary greatly by cancer type. In myelodysplastic syndromes and acute myeloid leukemia (AML), IDH1 mutations have been associated with worse outcome, shorter overall survival, and normal karyotype. However, in glioblastoma and astrocytoma, patients with IDH1 mutations have shown better overall survival than patients with wild-type IDH1. Unlike the association with cytogenetically normal AML, in glioblastoma, IDH1 mutations have been associated with specific cytogenetic abnormalities, 1p and 19q deletions.
No relevant information is available at the moment.