| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUUUGCAACGCCAUAGGCUUCCAGCGACUGCUGGUGAUGUUUCUGAUG… | 1578 nt | 0.5545 | |
| AGCCCGCGGCCAGGCAGCCGGGAGGAGCGGCGCGCGCUCGGACCUCUCC… | 2400 nt | 0.5562 | |
| AGCCCGCGGCCAGGCAGCCGGGAGGAGCGGCGCGCGCUCGGACCUCUCC… | 2658 nt | 0.5553 |
Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the mitochondria. It plays a role in intermediary metabolism and energy production. This protein may tightly associate or interact with the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014] CIViC Summary for IDH2 Gene IDH2 mutations have been observed in a number of cancer types, including sarcomas, hematologic malignancies, colon cancer and brain cancer. Mutations in the two isocitrate dehydrogenase enzymes involved in cytoplasmic (IDH1) and mitochondrial (IDH2) conversion of alpha-ketoglutarate to D-2-hydroxyglutarate have been described as mutually exclusive in many of these cancer types. The most frequent mutations involve R132 (IDH1) and R172 (IDH2) involve the active site and result in neomorphic enzyme activity. Although IDH2 (R172) mutations are associated with poorer overall prognosis in AML patients, its utility as a prognostic marker in MDS is still under debate. Additionally, IDH2 (R140) has been associated with improved overall survival in AML. IDH2 mutations have been associated with improved prognosis in gliomas.
A study in mice demonstrated that exertional heat stroke induced a sustained DNA methylation memory in the left ventricular myocardium after 30 days of recovery, with the IDH2 exhibiting two strongly methylated differentially methylated cytosines near its transcription start site, though this epigenetic change did not correlate with a difference in its mRNA expression at rest [Murray et al. DOI:10.1152/physiolgenomics.00147.2021].