| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUGAGGGGCACCAGAGGAGCAGACUACAAGAAUGGCACACGCUAUGGA… | 1849 nt | 0.4521 |
This gene encodes indoleamine 2,3-dioxygenase (IDO) - a heme enzyme that catalyzes the first and rate-limiting step in tryptophan catabolism to N-formyl-kynurenine. This enzyme acts on multiple tryptophan substrates including D-tryptophan, L-tryptophan, 5-hydroxy-tryptophan, tryptamine, and serotonin. This enzyme is thought to play a role in a variety of pathophysiological processes such as antimicrobial and antitumor defense, neuropathology, immunoregulation, and antioxidant activity. Through its expression in dendritic cells, monocytes, and macrophages this enzyme modulates T-cell behavior by its peri-cellular catabolization of the essential amino acid tryptophan.[provided by RefSeq, Feb 2011]
A study in humans demonstrated that the IDO1 (IDO1) mRNA is a differentially expressed gene elevated in middle-aged individuals and is linked to type I interferon signaling, contributing to its identification as an age-related transcriptional marker [Liao et al. DOI:10.1016/J.Fsigen.2025.103373].