Basic Information

Symbol
IER3
RNA class
mRNA
Alias
Immediate Early Response 3 PRG1 IEX-1L IEX-1 DIF-2 Radiation-Inducible Immediate-Early Gene IEX-1 Differentiation-Dependent Gene 2 Protein Immediate Early Response 3 Protein PACAP-Responsive Gene 1 Protein Immediate Early Protein GLY96 Protein DIF-2 DIF2 IEX1 Expressed In Pancreatic Carcinoma Immediately Early Gene X-1 Gly96, Mouse, Homolog Of Anti-Death Protein Protein PRG1 GLY96
Location (GRCh38)
Forensic tag(s)
Wound age identification Cause of death analysis

MANE select

Transcript ID
NM_003897.4
Sequence length
1237.0 nt
GC content
0.5812

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-476.40 kcal/mol
Thermodynamic ensemble
Free energy: -497.33 kcal/mol
Frequency: 0.0000
Diversity: 244.02
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((....(.(((((..((((((((((((((((((.(((..((((((.((((.((((((((((((((((.(((.((..((((.(((((((((.(((((((((....)))).)(((((((((....((((...((......))...)))))))))))))(((((((..(((((.((((((....))))))...)))))..))(((((.(.((((((.((((((.....((((((.((((..(((....))))))).))))))....)))))).)).....)))).).))))).)))))....((((.(((((.((((........)))).))))).))))....((((((.(((....))).)).))))((((..(((((((((..((.(......(((((.(((.(((.((((((((((.....(((((.((((.((.(((((((.(((((((((((...........)))....((..((((.((.((((((((...((((......((...((........))...))......)))).)))......)))))..)).)))).)).))))))))((((.....))))..)))))))...)))))).)))))........(((....))).....)).))))))))))).(((.((.(.(((((((..(((...((..((((((((.(((..(((((.....)))))..)))))))(((((((.(((((...................)))))))...........(((.(((((.(((((((..((((........))))...)))))))))))).))).....(((((((....)))))))...)))))(((((.......))))).))))..)).....)))..))))))).).)))))))).))))).).)).)))..))))))....)))).......)))))))))....)))).)))).))..).))..)).))))))..)))..))))))))).)).))))...)))))))).))))((((((((.((((.((((((((.((((........))))...))))))......((((.(.((((.....))))))))).....((((.((((((((...)))))))).)))))).))))))))))))..)))))))))...))))).)...))))))...((.((((((((((...)))))...............)))))...)).
Thermodynamic Ensemble Prediction
.((((((....(.(((((..((((((((((((((((((.(((..((((((.((((,(((({(((((((((((.(({.((..((((.(((((((((.(((({((((....)))).}(((((((((....((((...((......))...)))))))))))))(((((((,.(((((.((((((....))))))...))))),.}}(((((.(.((((((.((((((.....((((((.((({.,(((....))))))).))))))....)))))).)).....)))).).))))),))))).{{,((((.(((((.((((........)))).))))).))))})..(((({(,(((....))).)).))))((((..(((((((((,.((.{.,,,..(((((.((({(((,(((((((({(.....(((((.((({{,(,(((((({.{((((((({(,.....,......,,,,..{{.....{.{{.{{{,((({...((((......{{.,.({........)}...}}......}}}}.}}},.{((((((....))))))).|}.}))))))}{{((,....)))}..})))))),..,))))}.)))))........(((....)))....,)),)))}))))}))}|},}})}{.{{{||{|.,|||,}.|{..((((((((.(((..(((((.....)))))..)))))))(((({((.(((((...................)))))}}.....,,,,..,{{.{{{{{((((((((,.((((........))))..,)))))))))}}}.}}}.....(((((((....))))))).,.)))))(((((.......))))).))))..))..,,,}}).})))})})}),}.)))))}.))))).}.}}.))}..))))))....)))).......)))))))))....)))).)))).))..}.)}..)).))))))..)))..))))))))).)),}))}...)))))))).))),((((((((.((((.,,((((((.((((.{.....,))))...))))))......((((.(.((((.....))))})))).....((((.((((((((...)))))))).))))),.)))))))))))).,)))))))))...))))).)...))))))...({.{(((({((((...}}}}}...........}...)))))...)).

Transcripts

ID Sequence Length GC content
ACUUGGCCUUACACUCCGCUCGGCUCACCAUGUGUCACUCUCGCAGCUG… 1237 nt 0.5812
Summary

This gene functions in the protection of cells from Fas- or tumor necrosis factor type alpha-induced apoptosis. Partially degraded and unspliced transcripts are found after virus infection in vitro, but these transcripts are not found in vivo and do not generate a valid protein. [provided by RefSeq, Jul 2008]

Forensic Context

A study in Sprague-Dawley rats demonstrated that the IER3 mRNA expression in contused skeletal muscle significantly increased at 4h post-injury, peaked at 8h, and remained elevated within 24h, showing a time-dependent pattern useful for wound age estimation [Li et al. DOI:10.1007/s00414-023-03095-x]. In C57BL mice, the IER3 mRNA was up-regulated 4.78-fold in bone marrow cells 6h after 6.5 Gy ionizing radiation, indicating its role in the early response to radiation injury [Dai et al. DOI:10.1080/09553000600857389].