| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUUGGCCUUACACUCCGCUCGGCUCACCAUGUGUCACUCUCGCAGCUG… | 1237 nt | 0.5812 |
This gene functions in the protection of cells from Fas- or tumor necrosis factor type alpha-induced apoptosis. Partially degraded and unspliced transcripts are found after virus infection in vitro, but these transcripts are not found in vivo and do not generate a valid protein. [provided by RefSeq, Jul 2008]
A study in Sprague-Dawley rats demonstrated that the IER3 mRNA expression in contused skeletal muscle significantly increased at 4h post-injury, peaked at 8h, and remained elevated within 24h, showing a time-dependent pattern useful for wound age estimation [Li et al. DOI:10.1007/s00414-023-03095-x]. In C57BL mice, the IER3 mRNA was up-regulated 4.78-fold in bone marrow cells 6h after 6.5 Gy ionizing radiation, indicating its role in the early response to radiation injury [Dai et al. DOI:10.1080/09553000600857389].