Basic Information

Symbol
IFI30
RNA class
mRNA
Alias
IFI30 Lysosomal Thiol Reductase GILT IP30 Gamma-Interferon-Inducible Lysosomal Thiol Reductase Legumaturain IFI-30 IP-30 Interferon Gamma-Inducible Protein 30 Preproprotein Gamma-Interferon-Inducible Protein IP-30 MGC32056 Interferon, Gamma-Inducible Protein 30 Interferon Gamma Inducible Protein 30 IFI30, Lysosomal Thiol Reductase EC 1.8.-.-
Location (GRCh38)
Forensic tag(s)
Wound age identification Mechanical injury analysis Individual identification

MANE select

Transcript ID
NM_006332.5
Sequence length
988.0 nt
GC content
0.5557

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-338.00 kcal/mol
Thermodynamic ensemble
Free energy: -356.66 kcal/mol
Frequency: 0.0000
Diversity: 269.67
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((..((.........))..)))).(((((......))))).......(((......((((((((.((((((((((.(((......)))))))))))))(((((.......)))))..(((((.((((((((((((....((((.((.((.....))....((((.........)))).)).)))))))))))))))).)))))...(((..(((..(((......)))..)))))).....)))))))).(((((((..(((((...)))))))))..........)))(.((((((((((.(........(((....((((.(((((.((....))...))).........(((((((.((((((.((.....(((((((..(((((((((((((.((..((((((((((((....))))...))))))))...(.(.((.((((((.(((.((((((((((((((((.((((..((((((..(((.((((((((....)))....))))))))..))))))..(((....)))((((....))))....)))).))...)))))))((((..(((((.((((.....)))).)))...((((((.((.((.((((((..............)))))).))))))))))..........(((...)))..(((((..(((((((.(((.(((.((((.(((........).)).)))).))).))).))..)))))..))))).......))))))))))))).))).)))))).)).).)..(.(((((((......))))))).).((((.(((.((...)).))))))))))))))))))...))))....)).))))))).)))))).)).))))).....((((((.....))))))))))))....)))........).)))))))))).).....((.(((.......))).))((((.((....)).))))...)))
Thermodynamic Ensemble Prediction
((((..(((,({((((,.{{(,(((((((.{(((((({((((((((.,...(((((((((((((((.((((((((((.(((......)))))))))))))(((((.,.....}))))..(((((.((((((((((({...{((((.((.({.....,,..,.((((.........))))}})})))))))))))))))).)))))...(((,.{({..{{|,.....}}}..}))))).....))))))))....((((.{(((,,...,))))))))...{{{{((,,,,|}}})),|||}({{...}}}..,|,|,,...,|||{,,...}}....)}}})))))))....)..)))))).))}))).)}),,..)),})))).)).}.,}}}|{||},..||||,,||||||}..}))))}}.}||,||||...((((((((((.{,.,(({(((({(,{,,,,|||,.||,|}}||,|||.,,((.{,(((((((..{{||{{{.|,.,||,|{{{{({{{..{{{..,,)))|||{....)}||,,..,,}},))},}}}}.|||(,(...((((({((,,...}}))),})),..}.}}}||.}|.)|}||,|||}}}},,,..,....||{{|.{|{{{,,(((((.{{((({..(((...}))..(((((..(((((((.(((.(((.((((.(((........).)).)))).))).))).))..)))))..)))))..,,...{((((....)))))},},}||,,..,}))})){{.(((((((......)))))))||.((((,{((.((...)).))))))),)).......,||...,,))}})..))))).)))).........{(((,...(((({((.,,,.}}}}}}}.}))),,.,,.....,,,,...))))).))))).}}}),)).,(((({....))))).{{{{.{{....}}.}}}}......

Transcripts

ID Sequence Length GC content
GCAGUCGCCACACCUUUGCCCCUGCUGCGAUGACCCUGUCGCCACUUCU… 988 nt 0.5557
Summary

The protein encoded by this gene is a lysosomal thiol reductase that at low pH can reduce protein disulfide bonds. The enzyme is expressed constitutively in antigen-presenting cells and induced by gamma-interferon in other cell types. This enzyme has an important role in MHC class II-restricted antigen processing. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rats and pigs demonstrated that the IFI30 exhibited analogous time-dependent expression patterns in skeletal muscle following contusion injury and was validated as part of a key gene set enabling a cross-species prediction framework for injury time inference, achieving 81.1% accuracy on an independent porcine test set [Wang et al. DOI:10.1007/s00414-026-03727-y]. In human subcutaneous adipose tissue from BMI-discordant monozygotic twins, the IFI30 was upregulated in heavier co-twins and associated with cytokine-mediated signaling and immune system processes, linking its expression to inflammatory pathways in obesity [Muniandy et al. DOI:10.1038/ijo.2017.95]. A study in mice demonstrated that the IFI30 is upregulated in skeletal muscle following both local and distant burn injury, showing increased expression at 1 and 3 days post-local burn and at 1 and 2 days post-distant burn [Padfield et al. DOI:10.01.ta.0000230567.56797.6c]. In a separate mouse model of mild traumatic brain injury, the IFI30 transcript was found to be upregulated 4.2-fold in the injured ipsilateral neocortex three days post-injury, associated with antigen processing and presentation [Israelsson et al. DOI:10.1089/neu.2008.0676].