| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGUCGCCACACCUUUGCCCCUGCUGCGAUGACCCUGUCGCCACUUCU… | 988 nt | 0.5557 |
The protein encoded by this gene is a lysosomal thiol reductase that at low pH can reduce protein disulfide bonds. The enzyme is expressed constitutively in antigen-presenting cells and induced by gamma-interferon in other cell types. This enzyme has an important role in MHC class II-restricted antigen processing. [provided by RefSeq, Jul 2008]
A study in rats and pigs demonstrated that the IFI30 exhibited analogous time-dependent expression patterns in skeletal muscle following contusion injury and was validated as part of a key gene set enabling a cross-species prediction framework for injury time inference, achieving 81.1% accuracy on an independent porcine test set [Wang et al. DOI:10.1007/s00414-026-03727-y]. In human subcutaneous adipose tissue from BMI-discordant monozygotic twins, the IFI30 was upregulated in heavier co-twins and associated with cytokine-mediated signaling and immune system processes, linking its expression to inflammatory pathways in obesity [Muniandy et al. DOI:10.1038/ijo.2017.95]. A study in mice demonstrated that the IFI30 is upregulated in skeletal muscle following both local and distant burn injury, showing increased expression at 1 and 3 days post-local burn and at 1 and 2 days post-distant burn [Padfield et al. DOI:10.01.ta.0000230567.56797.6c]. In a separate mouse model of mild traumatic brain injury, the IFI30 transcript was found to be upregulated 4.2-fold in the injured ipsilateral neocortex three days post-injury, associated with antigen processing and presentation [Israelsson et al. DOI:10.1089/neu.2008.0676].