Basic Information

Symbol
IFIH1
RNA class
mRNA
Alias
Interferon Induced With Helicase C Domain 1 MDA-5 MDA5 Helicard IDDM19 Hlcd Interferon-Induced Helicase C Domain-Containing Protein 1 Clinically Amyopathic Dermatomyositis Autoantigen 140 KDa Melanoma Differentiation-Associated Protein 5 Melanoma Differentiation-Associated Gene 5 RNA Helicase-DEAD Box Protein 116 Murabutide Down-Regulated Protein Helicase With 2 CARD Domains RIG-I-Like Receptor 2 CADM-140 Autoantigen RLR-2 Interferon-Induced With Helicase C Domain Protein 1 DEAD/H (Asp-Glu-Ala-Asp/His) Box Polypeptide EC 3.6.4.13 SGMRT1 IMD95 RH116 AGS7
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_022168.4
Sequence length
3581.0 nt
GC content
0.4323

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-977.20 kcal/mol
Thermodynamic ensemble
Free energy: -1050.59 kcal/mol
Frequency: 0.0000
Diversity: 901.72
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.................(((((.(((....)))((((..(((((.(((((.(((((.((.(.((((((((((.((((((((((..(((((((.(((.............)))..)))))))..((((((...........))))))..(((.(((((.(((((((((((.....((((((..(....)..))))))((.((((.((...))))))))((((((.((...((.((....)).))...)).))))))..((((.(((((...))))).))))..)))))))))))...))))).)))...........)))))(((((...........)))))..((((((....)))))).....(((((..((((..(.(((..((((....)).))..))).).)))).....)))))............))))).))))))..((((...(((((((((.(.((((.((.......(((..(((((.((((....)))))))))..)))......)).)))).).))))))...)))))))((((.((((...))))))))(.((((..(((((((.(((((...((((..((.((.((.((((((..((((((((((.(..((((....))))..).))))((((.....)))))))))).)))))))).)).))..)))))))))(((((..((((....)))))))))....))))))).)))).)...)))).).)).))))).)))))...)))))..))))...(((.((((((((((((.(((.((.(((((((.(((.(.....((((.((((((((((.((.((.(((((.((..(............((........)).............)..)).)))))..)).)).)))))).))))..))))).)))))))))).)).....(....).))).)))))))))))))))..)))))(((((....)))))...((((((((((...((((((((.((((((((.(.(((((((((..((((((((....))))))))..((((((.((((....((((((....(((((.(((((.((((((.....)))...((((((..(....)..))))))(((((((((((((((((.(((((...(((.....)))...)))))((((((((...((....(((((((((((((.....((((..(.(((((((.((.(((((((.......((((..(((.((((((.(((((((..((((......((((......)))).)))).((((((.((....)))))..)))(((((((((((....(((((((((((((.(((((..((((....(((((((((.....)).(((.(((((((((....((..((.....((((((((((((..........(((......)))..........))))))))..))))...))))....))))))))).)))..((((((......((((((((....))))))))...(((((((((.......))))))))).(((((((((......))))....)))))....(..((((((((....))))...))))..)...))))))...)))))))................)))).))))).))))))))....((((..(((.((..(((((((((((.((((...((((((((((........((((((..(((.((((((((.((.(((((....)))))....(((....)))...........................(((...(((((((....(((((((((.............)))))))))))))))).)))..(((........)))......(((((.........)))))....)).)))))...))).)))....)))))).......(((((.((((.(((.....((.......)).((..(((((...........)))))...))............(((((((...(((....((((((((....(((((.(((((((..............)))))))..)))))..)))))))))))...(((((.....)))))......))))))).......((((((((...((.....((((.....(((..(((((((....((((((((..((........))))).)))))...)).))))).....))).....))))....))..(((((...((((((.........)))))).)))))..))))))))(((.....))).))))))).))))))))).))))))...))))))))))))))).)).)))..))))((((((....))))))..(((.......)))......))))).....((((.....))))((((......))))...))))))))))).........................)))).))).))).......((((((((((((((((...((.(..((((....))))..).))..(((.((((((......((.((((((((((....))))))).(((((((((((((((........(((((((((..((....(((..(((...(((......))).))).)))))..)))))))))........((((...................)))))))))))...)).)))))).........(((((....((((.....))))))))).....))))).....)))))).)))...)))))..)))))))))))))).)))....))))....))))))))).(((.((....)).))).(((((..((.(((((((........)).))))).))..)))))..))))))).)..)))).....))).)))...)))))))(((.((((((((((....)))))))))).)))............))...))))).))).....)))))))))))))))))(((((((.....(((...............)))..........(((...)))...............................))))))).....(((((((((....((((((((((((...((((..((((...((........))..))))..))))..)))))))))...))).....)))))))))...((((((....((((((((((....(((((..(((((((.......((((....))))......(((..(((....)))...))).))))))))))))(((((........))))).(((........))).))))))))))))))))........(((......)))............(((((((....)))))))..))).)))))))))).....))))))..))))...)))..))).))))))))).))))))..)))))))))))...........((((((...........((((.(((.......))).))))..........))))))...((.(((((......))))).))...))))))))))..
Thermodynamic Ensemble Prediction
.....{,,{{,{.....(((((.(((....)))((((..(((((.(((((.(((((.(((((((,,{{{...{((,((((,.,..(((((((.(((.............)))..)))))))}}))))}(,.((((((({.|.{.,(({(((.(((((.(((((((((((..,,.{(((((,,({{,.|..|))))){{.((((.|,...))))))}}((((((.{|...,{.((....}}.}}...}).))))))..((((.(((((...))))).))))..)))))))))))...))))).))){(((((((((({.(({(((((...........}))))..((((((....))))))...,.({{{{.|{,,{{{(,{{(..((((.,,,||.}}..})||},},},...,.))})},}}.,,,,,...))).),))))))}}})))......((((((.(.((((.((.{,....(((..(((((.((((....)))))))))..)))..}}..)).)))).).))))))..)))..).})))))))).}}..)))))))...,,...(((((((.{((((...((((..((.((.((.((((((..((((((((((,,,,((((....)))).,).)))){(((.....)))})))))).)))))))).)).))..))))}})))|{((({,((((....)))),)))),...)))))))..((((({.....)))))).))))).)))))...)))))..))))...(((.((((((((((((.(((.((.(((((((,(((,{,....({({,((((((((((.{{.((.(((((.{{..{..,,,.......||.{{{{,..,,..||,.,,.....}..}).)))))..)}.,,.)))))).))))},}})}},},}))))))).)).....|....}.})).)))))))))))))))..))))),,|,,}},,,}))}...((((((((((.{((((.{,((((((.....))))))}.))))},((((((({....}))))))}.,..((((((.,...{{((((.({{(((.(((((({,,.{{{{.{..,..}}},}}}}||}}.}}}}}}.}})))}..(((((((((((((((((.(((,,..,{{{,,,,.,,|...}))))|{||{{{{...{,....(((((((((((((.,...((((..(.(((((((.((.(((((((....,..(({{,.(((.((({{,.(((((((..((((......((((......)))).)))).((((((.((....)))))..)))(((((((((((...,((({{((((((((.(((((..((((,...,|||||(((.....)).{((.(((((((((.,{,({..{(..,{.{{(,((((((((......,,,.(((,....,)))...,}}....))))))))..,}})},.)))},}}}))))))))),}}|,.{,{{{{.{{.,.(({(((((,,..||||||||,,.{{{((((((,......}}}))))}),,,|{{{{.,|||}}}}}}}}}},}}}|}|.,},},}||||{{{....)}))},,.,,,.{{{,..,,)))}..}))))}|{,.......}},....)))).))))).))))))))....{{{{..{{{,||,.(((((((((((.,,,(,,,((((((((((........((((((..,(({({.(((((.((,(((((....)))))....(((,...,,)......,|||.,...............(((...((((((({...(((((((((.............)))))))))))))))).)))..{{(..,,....)))......(((((.........)))))....)),)))))...,},.))),,..)))))).......(((((.((({,(({.....,,.......||.{{..{((({....,||||..||))},,,)),...........|{{,{{,...{{(....((((((({....(((((.(((((((..,.....}}....)))))))..)))))..)))))))))))...(({((.....))))){{{{..,,))))........{((((({{.,..,,...,({{{...,.{{{..{((((((....((((((((..,{........}}))).)))))...)).))))}.,,..}}}.,...}))}....||,.(((((...((((((.........)))))).))))).,)))))))){{{.....})}.})))))).))))))))).)))))).,})),)))))))))))).}|,|||,.}}}|((((((....)))))),.(((.......)))......})))),,...,|{{,,,..|,..,,{{|,,...)))),..)))))))))))......{{.....,,..........)))).))).,},.......{(((((((((((((((...{,.(..((((....))))..).||,.,,,.{((({{......{{.(({{((((((....))))))}.((((((((((((((,...{{,...{{((((((..{{....(((..((({{,{{{......))).))).))),),,)))}}}}|||,....,,{,,,.....,}}...........,))))))))))...)).)))))).........{((,((,.,,((({{....)))))})),,.,})))))..,..}}}))).}))...)))))..)))))))))))))).)))....)})}....))))))))).(((.((....)).))).(((((,.((.(((((((........))}})))).)).,)))))..))))))).)..))))...,.))),,))...))))))}(((.((((((((((....)))))))))).))).......,....}},,,,,,,..})))....))))))))))))))))).,...((((((((({{...,..,,{{.....{{{........}||,...,))}}.{{{(..((((((((((((((,,,.....,{((({,.....(((((((((....((((((((((((...((((..((((..,{{........})}.))))..))))..)))))))))...))).....))))))))).,.,,...,...{((((,{,,....}}|||{,..,,{{{|,......,{{{{....}}}|||||,..(({{,(({{.{(({{{{{,..||,|||,|,|||(((((........)))))}|,{,.......,},.|||||||,|||||||,.................)))}}..}}}}}}}.(((((((....}))))))}.},)))))))}.)))}.}}}}.|||,..,}}).,}},))))))))).)).)))...)))),{{{{{{,|},}}},...,,.,,.||||||||.,,,|,,|||}}}},,},,,.,,,}),))))))))))).,.))))))....{(.(((((......))))).)}...))))))))))..

Transcripts

ID Sequence Length GC content
CAAACUCUGUAAGAACUGCCUGACAGAAAGCUGGACUCAAAGCUCCUAC… 3581 nt 0.4323
Summary

IFIH1 encodes MDA5 which is an intracellular sensor of viral RNA that triggers the innate immune response. Sensing RNA length and secondary structure, MDA5 binds dsRNA oligonucleotides with a modified DExD/H-box helicase core and a C-terminal domain, thus leading to a proinflammatory response that includes interferons. It has been shown that Coronaviruses (CoVs) as well as various other virus families, are capable of evading the MDA5-dependent interferon response, thus impeding the activation of the innate immune response to infection. MDA5 has also been shown to play an important role in enhancing natural killer cell function in malaria infection. In addition to its protective role in antiviral responses, MDA5 has been implicated in autoimmune and autoinflammatory diseases such as type 1 diabetes, systemic lupus erythematosus, and Aicardi-Goutieres syndrome[provided by RefSeq, Jul 2020]

Forensic Context

A study in human keratinocytes and peripheral blood mononuclear cells demonstrated that pharmacologic inhibition of the pathway involving the IFIH1 did not block cytokine induction by UVB-irradiated keratinocyte lysates [Bernard et al. DOI:10.1038/nm.2861].