Basic Information

Symbol
IFIT1B
RNA class
mRNA
Alias
Interferon Induced Protein With Tetratricopeptide Repeats 1B BA149I23.6 IFIT1L Interferon-Induced Protein With Tetratricopeptide Repeats 1-Like Protein Interferon-Induced Protein With Tetratricopeptide Repeats 1B Protein IFIT1 Homolog B Interferon-Induced Protein With Tetratricopeptide Repeats 1-Like
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Cause of death analysis

MANE select

Transcript ID
NM_001010987.2
Sequence length
1972.0 nt
GC content
0.4270

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-551.00 kcal/mol
Thermodynamic ensemble
Free energy: -591.93 kcal/mol
Frequency: 0.0000
Diversity: 421.22
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......((.(.(((((.(((((.((....(((((((((....((((((..(((((.(((((((((.((((((.(((.((((.((........)).))))...)))...)))))).)))((((.((.(((..(((..((((((.....)))).))...)))..)))(((.((...(((((..........))))))).)))....)).))))...(((((((((.........(((((((..............(((((((((..((((((...((((......((((..((((((((((((.((.......(((((.......)))))......)).))........(((((.......))))).))))).)))))..)))))))))))))).....)))))))))......((....))((((......))))....((((.....))))(((((.....))))).....))))))).........).)))))))))))))).))))).........(((.((((((....((((((.......)))))).....)))))).)))))))))...))))).))))((((((((((((..((((.............))))(((.......))).(((((.((((((.........(((((..(((((((((........)))))))))..(((......))).)))))........)))))).)))))......))))))))).)))(((((((((((((((((.(((..(.((((((((.((((.....(((..((((.((((.((((.....(((.....(((((((((((...(((((......((......))......)))))...)))))))))))....)))...))))))))...))))..)))((.(......))).)))).).)))))))).)))))...)))))))).....)))))))....((((....))))(((..((((.....))))..)))...(((((((((((((...((((((.....((..(((((...((.....))....)))))..))((..((((((......))))))..)).((((((((.(((.....((......))...)))..)))))))))))))).....(((((((...)))))))..(((((((((((((..(((((....))))).....(((((.((((((((...((((.(((((((.((((.........(((((.(((..(........)..))).))))).......(((((((((((..((........((((......)))).....(((.(((((((((((......(((((.....((((.......((((((((.(((((..((..((((((((((((...((((((.(((...........)))..(((((((((....))))).))))......)))))).))))))))).)))..))..))))))))))))).))))...))))).((((((..((((.((((((.................)))))).))))...)))))).....))))))).)))))))......))..)))))))))))....))))..)))))))))))..)))))).(((((.......)))))...)))))))(((((((........)))))))((.((((((........)))))).))((..(((((((((((.((.......)).)))))).......)))))..))...(((((((...(........)...)))))))..)))))))...)))))).(((((......))))).))))))))..)))))...((((......))))......((((((.(((((((.(((.((........)).))).))).)))).))))))...)).))))).))))).).)).......................
Thermodynamic Ensemble Prediction
.......((.(.(((({.(((({,((..,.{((((((((....((((((.,(((((.(((((((((.((((((.(((.((((.((........)).))))...)))...)))))).))),{{{.{({(((..{((,{{{{{{{||}}.},))}}}...|||,,|}|(((.((...(((((.{{....,}.))))))).)))....},,)))),,.(((((((({.........(((((({........,..{,.(((((((((..((((((...((((......((((..((((((((((((((,....}||||{{{.......}}},,...,.....}},...,,,}|{{{{.......))))).))))).)))))..)))))))))))))).,...)))))))))}}...{((....}}|(((......)))}...||(((.....)})|(((((,...,))))),....})))))).........}.)))))))))))))).))))).}.......(((.((((((...{({((((,......}))))..,}..)))))).)))))))))...))))).)))}((((((((((((..((((.............)))),,{.......,}}.(((((.((((((.........(((((.,({{{{((((.....,,.}}}}}}})),.{{|,,,...}}),)))))........)))))).)))))......))))))))).))){((((((((((((((((.(((..(.((((((((.((((.....{((..((((.(((,{((((.,...(((.{{{,{{(((((((((...(((((,.,,{.((......))..,,,.)))))...)))))))))))}}..)))...))))))))...))))..))|({........,)}.)))).)}}))))))).)))))...)))))))).....))))))}....{{{{....,}}}(((..((((.....))))..))).,,((((({(((((((...((((((.....,,..((((({,.((.....)).,},})))}..}|((..((((((......))))))..)).{(((((((.{{{.,,,,{{......}}..,)}}..)))))))))))))).....(((((({...|})))))..(((((((((((((..(((((....))))).,,..,{(({.{,((((((...((((.(((((((.((((.......{,{{(((.{{{{,{,.,,,...}..}}}.}}}}}..,{{..{(((((({{{{,,{{........((((......)))).....((({({{.,,,{|,|}}},..,{({{....{,{{{,,,....{(((((((.(((((..((..((((((((((((...((((({.(((,,.........({.{(((((.....)))))).)).,,,..}}.}}}))))).))))))))).)))..))..)))))))))))))..,,,..,||||{{(((((......}}}||||{,,.,......,|||...}}))))..,,,...,,})))}}..))),,))),}}}}},,.,,...,)}})))))))))))..,,))))..)))))))))))..)))))).|{{{(,..,,..,}))}...,,)))}}{((((((........)))))))((.((((((........)))))).))((..(((((((((((.(,,,,....)),)))))).......)))))..))...(((((((...{........,...)))))))..))))))),..,))))).{((({......))))}.))))))))..)))))..||{((|.....}}},,},,..((((((.(((((((.(((.((........)).))).)))}}})).))))))...,)}))))).))))).).)).......................

Transcripts

ID Sequence Length GC content
AGAACUCUGUGGAUGAACCUUGAAGGAGCCUCCAAGCCUGAACCAAAGC… 1972 nt 0.4270
Summary

Predicted to enable RNA binding activity. Predicted to be involved in defense response to virus. Predicted to act upstream of or within cellular response to interferon-alpha; cellular response to interferon-beta; and response to bacterium. Predicted to be located in cytoplasm. Predicted to be active in cytosol. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in humans demonstrated that the IFIT1B mRNA is a body fluid-specific marker for venous blood identification, with its expression restricted to blood samples [Yu et al. DOI:10.1016/j.fsigen.2025.103416]. In a separate human study, the IFIT1B was identified as a potential prognostic biomarker significantly associated with 28-day mortality in sepsis via Mendelian randomization analysis, though it was not selected for further mechanistic investigation [Li et al. DOI:10.1038/s41598-025-99619-z].