Basic Information

Symbol
IFIT2
RNA class
mRNA
Alias
Interferon Induced Protein With Tetratricopeptide Repeats 2 Interferon-Induced Protein With Tetratricopeptide Repeats 2 ISG-54K GARG-39 IFI-54 ISG-54 Cig42 G10P2 IFI54 Interferon-Induced 54 KDa Protein ISG-54 K IFI-54K IFIT-2 ISG54 P54 Interferon, Alpha-Inducible Protein (MW 54kD) Interferon-Induced Protein 54 CIG-42
Location (GRCh38)
Forensic tag(s)
Chronological age estimation Sudden cardiac death diagnosis Sudden unexpected death diagnosis

MANE select

Transcript ID
NM_001547.5
Sequence length
3393.0 nt
GC content
0.4173

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-937.80 kcal/mol
Thermodynamic ensemble
Free energy: -1003.68 kcal/mol
Frequency: 0.0000
Diversity: 681.59
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((((((.....((((((((((((((..(((...((.((...))))..)))...))..)))))))(((.....((((...(((((..((((......((.(((((((((((((((.......))))..(((((.(((...(((((((((((((....))))))..((((((((((.(((..(((..........)))..))))))))))))).........((((...)).)).........((((.......((.(((...)))))......))))((((((((...((((...(((((((((((((((......((((((((((.((((((((((...........)))))))(((((((((..(((.((.(((.(((((((.((.(((((..(((((((..(((.(((((.((((((..(((..((.(((((.(.((...)).).))))))).)))..)))))).))))).))).)))).))).)))))..))..))))))).))).)).))).(((......)))...........(((.(((((..(((((((.((((((.....)).)))).......((((........(((((((((((........))))..)))))))...))))......)))))))))))).)))...(((((((((......(((((((((...((.....((..(((((.....(((((.(.(((......((((((.......))))))..))).).))))))))))..))..))...)))))))))...)))))))))....)))))))))...))))))))))).))((((((((.(((((((..........((((((((((((............(((((((...(((((((((((((..........((((((......))))))(((...)))((..((((((((((.....((((((...(((.(((.(((...((((.(((((..((.(((...(((((......((((((.....((((((((..(((((((((...........))))).))))..)...........)))))))))))))))))).))))).))))).))))...)))))).)))))))))...((((.((((((((....)))....)))))...))))..))))))))))..))..(((((((((....((((((((........))))))))..((((((((.(..((........))..)))))))))((((((((((........((.........))..........................((((....)))).....))).)))))))....)))))))))))))))))))))).((..((((((.......))))))..))((((((((..(((((((((((((.......(((.((((((.((((((((..(((((..(((((((((((((.....)))))...)))).)))).(((((..(((.((((((((....(((....)))....)))..............))))).)))..)))))....(((((.((((((((((((((...((..((........)))).))))))))(((......)))((((((..(((((.((((((((((....(((.(((...(((((.....((.(((((.....(((.(((((((((((((.(.((((((((((.((((....)))).(((((((((((((.((((((..(((....(((((((.((...........(((((((....)))))))((((.((((.((((....)))))))))))).....(((((........))))).........)))))))))(((((....))))))))..))))))..)).)))))))))))..((.((((((....)).)))).)))))))...))))).).)))))..(((((.....)))))...))))))))))).....))))).))))))).))))))...)))))).....((((.((((((((..((.(((...)))))))))))).)..)))).)))).)))))..))))))...((((..((((((((((.........((((...(((.(((((..(..(((((..........)))))..)..).)))).)))..))))....((((.....)))).)))))))))))))).)))))).)))))....(((.(((((........))))).))).(((((((.((..(((((((((((((((((((.....(((.(((.............((((((......((((((((....(((...((.....((((((((((((..((((.(((((.....(((((((((....((.....))..)))))))))......))))).)))).....))))))))))))......))...)))...))))))))...(((((((....(((.(........))))..))))))).......))))))(((.(((........))).)))))))))....)))))))).)))).....((((.((.((((....))))))))))...)))))))...)).)))).))).....)))))....))))))))..)))))).)))...(((((((.....((((.((......(((((.(((.......(((.(((((((..((((...(((.((....(((((....)))))....))))).))))...))))))).)))....))).)))))......)).)))).(((((((((..(((((..(((((.....((((.....((((((((((.........)))))).))))...))))..)))))..)))))))))))))).(((((....))))))))))))......))))..........)))))))))......(((.((..(((((((((((...))))).))))))..)).)))....))))))))...............((((......)))))))))))..))))))))))))))))))).))))))))...(((.(((((...((((...))))....))))).)))...(((((((((.......(((............))).......)))....))))))..........))))))....))))))))).))))))))))))........(((.((.(....).)).)))...))))))).))).)))))...(((((...)))))(((((.....)))))))))))))))).))..)))))))))..))))..)))))))).....))))))))..)))).))(((......)))....................
Thermodynamic Ensemble Prediction
((((((({(((((({{...((({(((((((({((,,,,...{{.((...}}}}..)))},..,...,}|}}}|||..,,|{|||...(((({.,((((......((.(((((((((((((((.......))))..(((((.(((...(((((((((((((....)))))}..(((((((((((({(..(((..........)))..))))))))))))).........((({....|,}}.......,}||{{.......((.(((...))))).....,}}}}(((((((({..,(((...(((((((((((((({......((((((((((.((((((((((...........)))))))(((((((((..{((.{(,({(.(((((((.((.(((((..(((((((..(((.(((((.((((((..(((..((.(((((.{.((...}).).))))))).)))..)))))).))))).))).)))).))).)))))..))..))))))).))),,,.})).{((......))}........,..(((.(((((..(((((((.((((((.....)),,))).......(((({.......))))),,{(((........)))}..}}}}||....,|||},.,,.)))))))))))).)))..,(((((((((......(((((((((...((.....((..(((((.....(((((.(.(((((...{(,((,,..}}.}},},,)),.))).).))))))))))..))..,}...)))))))))...)))))))))....)))))))))...))))))))))).))((((((((.(((((((..........((((((((((((,...........(((((((...(((((((((((((.....{{,,.((((((......)))))),,...,))){{..((((((((({.....((((((...(((.((,{(((...((((.{((((..(,.(((.,.,((((......((((((.....(((((((,..(((((((((...........)))))}})))..}...........)))))))))))))))))).))),}.))))}.))))...)))))).)))))))))...((((.((((((((....))),...}))))...))))..})))))))))..}}..(((((((((....((((((((........))))))))..{((((((({(..,,........},}}}}))))))},{{{((({{,.......,||......,...,..............,..,,.,.....((({....}))).....})}.,)))))}....)))))))))))))))))))))).({..{{{{{||.,,,.,||||}}.,))||{||{,,..((((((((((((((..(((((((....)))))))...)))))....,,(((((((((((((.....))))),..}))),,))).,..{((((.((((((.(((((((((((.{{,,,...,((((,......})))).(((((...,(((.((({.....{{{......(((((((((...,{..({........},,,.))))))))}.(((((((((((,,(((..({{{{{((((,(((((.,,,,,,.|||}}}|||,|}}}}.((.(((((.....((,{(((((((((((((.(.((((((((((.((((....)))).((((((((((({(.((((((..(((.,..((((({{{((..,........(((((((....)))))))((({,((((.((((....)))))))))))).....(((((........)))))......,..))))))))),((((....))))))))..))))))..}}.)))))))))))..((.((((({....)).)))}.)}))),)},.})))).).)))))..(((((.....)))))...))))))))))).....))))).))}}}}}.}|||||..,||||||..{{{(.,,.,((((({,.{((.(({...}))))))))))),,..)))).,))).}||||{.|||||,...((((..((((((((((...,,,...((((.{.(((.(((((..(..(((((........,.)))))..)..).)))).)))..))))...{{{,|....,))}).)))))))))))))}.,,{{|{,.,,{{,...{((,(((((.....,,,}||||,|}}..,||}.,}}}}.}}},,....,,}.,||||||}...,|||}|}|}........,}})))))))...,))}},|))))}........{{,{{(((((((({{,,....((((.(((((.....(((((((((....((.....))..)))))))))......))))).)))).....))))))))))))}.....,,..))),.}))))))))))..(((((((....(((.{........))))..))))))),},....,)))}.})})))))....,,)))))))))...))(((((((((((.((({{{....,,{{.((.((((....))))))}}}|,,,.,((({{(,,{,{{{{|,,,,.,,))}))},,,}},,|||||..{{,||{(({{,..,,......,},.,}).,,.}))))),}))}})).))))))))))).(((((((..((((...(((.((....(((((....)))))....))))).))))...))))))).))))))))))}((({(({,.......|}}|((((({((,.,((((,..,||||,..,.,|||,},..,{{,((((((.........)))))).}}}}...}}}},,||||,..})))))))))))))}(((((....)))))...,||||||,....,,,.....})},)))))))))....,.(((.((..(((((((((({...})))),})))))..)).))).,|.||}}}}},...............{{{{......}}}})))))))},))))))))))))))))))).))))))))...,,,.(((((...((((...))))....))))).|||...(((((((((,,,,...{,,............)))}......)))....))))))..........})))))....))))))))).)))))))))))).,|,....{{{.,|,.....),,,.,}),,.))))))).))).))))).,,((({,.,,)))},(((((.....)))))))))))))))),)}..)))))))))....}}}))))))))}....})))))})).,)))).)){({......}},........,.....,,....

Transcripts

ID Sequence Length GC content
GGCAGAAGAGGAAGAUUUCUGAAGAGUGCAGCUGCCUGAACCGAGCCCU… 3393 nt 0.4173
Summary

Enables RNA binding activity. Involved in antiviral innate immune response and positive regulation of apoptotic process. Located in endoplasmic reticulum. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in mice demonstrated that the IFIT2 is a hub biomarker for septic cardiomyopathy, showing significant up-regulation in heart tissue from LPS-induced models and validated by qPCR [Zhao et al. DOI:10.2147/JIR.S486763]. In human aging research, the IFIT2 is associated with epigenetic aging clocks as a top list gene [Solovev et al. DOI:10.1016/j.mad.2019.111192]. A study in human infants demonstrated that the IFIT2 was broadly upregulated in most cell types within the medulla of a sudden infant death syndrome (SIDS) case positive for human parechovirus 3, as revealed by single-nucleus RNA sequencing, indicating a significant host interferon-mediated immune response associated with occult neuroinflammation [Ramachandran et al. DOI:10.1001/jamaneurol.2023.5387]. In a separate study on human myocardial infarction, the IFIT2 was identified as one of the top ten upregulated differentially expressed genes in patient blood samples via RNA sequencing, highlighting its association with inflammatory pathology [Zhao et al. DOI:10.3892/etm.2017.5580].