| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAAACGACAGGGGAAAGGAGGUCUCACUGAGCACCGUCCCAGCAUCCGG… | 668 nt | 0.5539 |
Interferon-induced transmembrane (IFITM) proteins are a family of interferon induced antiviral proteins. The family contains five members, including IFITM1, IFITM2 and IFITM3 that belong to the CD225 superfamily. The protein encoded by this gene restricts cellular entry by diverse viral pathogens, such as influenza A virus, Ebola virus and Sars-CoV-2. [provided by RefSeq, Nov 2021]
A study in human infants demonstrated that the IFITM1 transcript was significantly enriched in vascular and ependymal cells within the medulla of a sudden infant death syndrome (SIDS) case with human parechovirus 3 infection and neuroinflammation compared to noninflammatory SIDS controls [Ramachandran et al. DOI:10.1001/jamaneurol.2023.5387]. A separate review of human post-mortem brain studies noted that the IFITM1 gene was identified as an upregulated immune/inflammation-related transcript in the hippocampus of subjects with schizophrenia [Wu et al. DOI:10.1111/pcn.12550]. In mice, transcriptomic analysis of the nucleus of the solitary tract following chronic intermittent ethanol exposure and stress showed upregulation of type I interferon signaling genes, with the IFITM1 identified as a hub gene in a module positively correlated with escalated ethanol consumption [Grantham et al. DOI:10.1016/J.Neuropharm.2023.109768].