Basic Information

Symbol
IFITM1
RNA class
mRNA
Alias
Interferon Induced Transmembrane Protein 1 DSPA2a CD225 Interferon-Induced Transmembrane Protein 1 Dispanin Subfamily A Member 2a IFI17 9-27 Interferon-Inducible Protein 9-27 Interferon-Induced Protein 17 Leu-13 Antigen Interferon Induced Transmembrane Protein 1 (9-27) CD225 Antigen LEU13
Location (GRCh38)
Forensic tag(s)
Sudden unexpected death diagnosis Forensic psychiatry evaluation Drug abuse diagnoses

MANE select

Transcript ID
NM_003641.5
Sequence length
668.0 nt
GC content
0.5539

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-224.80 kcal/mol
Thermodynamic ensemble
Free energy: -235.42 kcal/mol
Frequency: 0.0000
Diversity: 138.27
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........(((((...(((((((((.(((......((((........))))..(((.(.((.((((.((.....))((((........))))...............((((((.((((((...((........))....)).))))...))))))...(((((((((.....))))))))).........)))).)).).)))...........))).)))))))))(..((((..(((((((((..((((((((((..((((.((.....))...))))....(((((((((((................))))))))))))))))))..)))....)))))))))..))))..).((((....)))).....(((.((((((.(((((...((((((.......))))((((...........))))....)))))).).)))))).)))(((((((((.............))))))))).....(((((..((.(((((.....(((((.((((.((((.((((.((.((((((......))))))....))...)))).)))))))).)))))....))))).))..))))))))))((.(((.(((.(((((......((((.((....))))))......))))).)))..))))).....
Thermodynamic Ensemble Prediction
.....,..(((((...(((((((((.(((......((((........)))).....(((({....}))))....|.{({{........}}}}....,,,,,.,,,..,,{((({({{,.....{,..,,,,.,)}....)))))},..,)))}}||.,(((((((((.....)))))))))...,,.....,||,|,.,,|}},..........))).)))))))))({(((((..(((((((((,.((((((((((..((((.((.....))...))))....(((((((((((,(,....,,.......))))))))))))))))))..))).,..)))))))))..{{{(({{{((((,,..||,,.....||,.||{|||.,,,,,..,||||||}}....,))))||{{..,..,{,,..|||,...,)),}}}.,,)))}}}.)),(((((((((.............))))))))).....(((((..((.(((((.....(((((.((((.((((.((((.((.((((((......))))))....))...)))).)))))))).)))))....))))).))..)))))))))).,.,,,.(((.(((((......((({,((....))))))......))))).)))..}},,,,,,..

Transcripts

ID Sequence Length GC content
GAAACGACAGGGGAAAGGAGGUCUCACUGAGCACCGUCCCAGCAUCCGG… 668 nt 0.5539
Summary

Interferon-induced transmembrane (IFITM) proteins are a family of interferon induced antiviral proteins. The family contains five members, including IFITM1, IFITM2 and IFITM3 that belong to the CD225 superfamily. The protein encoded by this gene restricts cellular entry by diverse viral pathogens, such as influenza A virus, Ebola virus and Sars-CoV-2. [provided by RefSeq, Nov 2021]

Forensic Context

A study in human infants demonstrated that the IFITM1 transcript was significantly enriched in vascular and ependymal cells within the medulla of a sudden infant death syndrome (SIDS) case with human parechovirus 3 infection and neuroinflammation compared to noninflammatory SIDS controls [Ramachandran et al. DOI:10.1001/jamaneurol.2023.5387]. A separate review of human post-mortem brain studies noted that the IFITM1 gene was identified as an upregulated immune/inflammation-related transcript in the hippocampus of subjects with schizophrenia [Wu et al. DOI:10.1111/pcn.12550]. In mice, transcriptomic analysis of the nucleus of the solitary tract following chronic intermittent ethanol exposure and stress showed upregulation of type I interferon signaling genes, with the IFITM1 identified as a hub gene in a module positively correlated with escalated ethanol consumption [Grantham et al. DOI:10.1016/J.Neuropharm.2023.109768].