Basic Information

Symbol
IFITM2
RNA class
mRNA
Alias
Interferon Induced Transmembrane Protein 2 DSPA2c Dispanin Subfamily A Member 2c 1-8D Interferon-Induced Transmembrane Protein 2 Interferon-Inducible Protein 1-8D Interferon Induced Transmembrane Protein 2 (1-8D)
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden unexpected death diagnosis Postmortem interval inference

MANE select

Transcript ID
NM_006435.3
Sequence length
1006.0 nt
GC content
0.5686

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-358.60 kcal/mol
Thermodynamic ensemble
Free energy: -376.52 kcal/mol
Frequency: 0.0000
Diversity: 242.32
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((..(((((((((((((((....(((((((.(((((.(((((((.(((((((((((((((((..((....)).)))))(((((.(((((((((((.......))).))))))))..))))).........(((((......)))))........(((((...((((((.....)))))))))))..(((((((((((((((((((((((.........(((...)))((.(((((((.(((......(((((....)))))....)))...))))))).))))).)))))...(((((.....))))).......)))))))))).)))))))))).......)))))))..((((.((((((((.(.(((.(((.....))).)))).((((.(((.(((((((..((((((..((((((........)))..)))...((.((((((((..((.....((.(((((...))))))))))))))))).)).......((((.((.((((((...(((((.(.....).)).)))...))))))))))))...((((((............)))))).))))))((((((((((((................)))))))))))))))))))))).))))))))..)))).))))((((((....((((((((..(((...(.(((((((((.(((((...((((..((((((...............))))))..)))).))))))))).......))))).).)))........))))))))..))).))))))).)))))))).).).))))).....)))).))))).....))))))..)))))))..(((((((.((((.((...)).)))).)))(((.......)))..............((((..((((....)))).))))....((((..((.((((((........(((..........))).....)))))).))..))))..)))).
Thermodynamic Ensemble Prediction
((((((,.{((((,((((((({((..|.((((({{.(((({{(((((((.((((((((((((((({({.((....)).))))|(((((.(((((((((((.......))),}))))))).,})))).........(((((......)))))........(((((..,((({((....,)))))})))))..(((((((((((((((((((((((.........{{,...}},((.{((((((.(((......(((((....)))))....)))...))))))).)))))}}))))...(((((.....))))).......)))))))))).)))))))))).......)))))))..{{((.((({,{{((((({,..||.,}}},...{{((.{(((.(((.(((((((..((((((..((({((........)}),.)))...((.((((((((..{({,...,|}|((((...))))}}...)))))))).)),.,|...{({(.({.{{{{{{...{{(({.(,,...},}|,,}}..,)))}))))))))...((((((............)))))).))))))((((((((((((.(,....,,.......)))))))))))))))))))))).)))).))}.,)))).)))|(((({({{{{((((((((..{{{...{.(((({((((.(((((...((((..((((((,,.....},......))))))..)))).))))))))),,.....)))))}}.)))...,....))))))))..,,,}))))))).)))))))},|,|.}}},,....}}}),.,............|||,.((((((....))).)))}))).)}}))))},,,).)}}}}.....,,..,)}))},.,,}}}...||||..{(({....))}},|}||....((((..((.((((({........(((.,........))}.....}))))).))..))))..)))),

Transcripts

ID Sequence Length GC content
GUGGGGCCUGGAGUGUGGAGGCGUCAGCGCAGGCCUGGCAGGAGCCCUG… 1006 nt 0.5686
Summary

Interferon-induced transmembrane (IFITM) proteins are a family of interferon induced antiviral proteins. The family contains five members, including IFITM1, IFITM2 and IFITM3 and belong to the CD225 superfamily. The protein encoded by this gene restricts cellular entry by diverse viral pathogens, such as influenza A virus, Ebola virus and Sars-CoV-2. [provided by RefSeq, Nov 2021]

Forensic Context

A study in humans identified the IFITM2 as a core gene via weighted correlation network analysis, with qPCR validation showing its expression was significantly higher in the sepsis group compared to healthy controls and its expression levels were positively correlated with patient survival [Wang et al. DOI:10.1371/journal.pone.0317608]. In a separate human infant study, single-nucleus RNA sequencing of brainstem tissue from a sudden infant death syndrome case with human parechovirus 3 infection revealed transcripts for the IFITM2 were significantly enriched in vascular and ependymal cells, indicating a host immune response to occult neuroinflammation [Ramachandran et al. DOI:10.1001/jamaneurol.2023.5387]. A study in mice demonstrated that the IFITM2 (Ifitm2, Interferon induced transmembrane protein 2) was part of a seven-gene transcript set from liver tissue that provided accurate postmortem interval (PMI) predictions using linear regression analyses, yielding an R² of 0.98 and a slope of 0.97 between predicted and actual times [Hunter et al. DOI:10.1016/J.Forsciint.2017.02.027].