| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUGGGGCCUGGAGUGUGGAGGCGUCAGCGCAGGCCUGGCAGGAGCCCUG… | 1006 nt | 0.5686 |
Interferon-induced transmembrane (IFITM) proteins are a family of interferon induced antiviral proteins. The family contains five members, including IFITM1, IFITM2 and IFITM3 and belong to the CD225 superfamily. The protein encoded by this gene restricts cellular entry by diverse viral pathogens, such as influenza A virus, Ebola virus and Sars-CoV-2. [provided by RefSeq, Nov 2021]
A study in humans identified the IFITM2 as a core gene via weighted correlation network analysis, with qPCR validation showing its expression was significantly higher in the sepsis group compared to healthy controls and its expression levels were positively correlated with patient survival [Wang et al. DOI:10.1371/journal.pone.0317608]. In a separate human infant study, single-nucleus RNA sequencing of brainstem tissue from a sudden infant death syndrome case with human parechovirus 3 infection revealed transcripts for the IFITM2 were significantly enriched in vascular and ependymal cells, indicating a host immune response to occult neuroinflammation [Ramachandran et al. DOI:10.1001/jamaneurol.2023.5387]. A study in mice demonstrated that the IFITM2 (Ifitm2, Interferon induced transmembrane protein 2) was part of a seven-gene transcript set from liver tissue that provided accurate postmortem interval (PMI) predictions using linear regression analyses, yielding an R² of 0.98 and a slope of 0.97 between predicted and actual times [Hunter et al. DOI:10.1016/J.Forsciint.2017.02.027].