| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGAACCAUCCCAGUAACCCGACCGCCGCUGGUCUUCGCUGGACACCAU… | 611 nt | 0.5810 |
Interferon-induced transmembrane (IFITM) proteins are a family of interferon induced antiviral proteins. The family contains five members, including IFITM1, IFITM2 and IFITM3 and belong to the CD225 superfamily. The protein encoded by this gene restricts cellular entry by diverse viral pathogens, such as influenza A virus, Ebola virus and Sars-CoV-2. [provided by RefSeq, Nov 2021]
A study in mice demonstrated that the IFITM3 was identified as a hub gene in a microglia-localized, 72-hour post-withdrawal gene module positively correlated with ethanol consumption, indicating its association with drinking escalations in alcohol-dependent animals [Grantham et al. DOI:10.1016/J.Neuropharm.2023.109768]. In human infants, interferon-induced transmembrane protein transcripts, including the IFITM3, were significantly enriched in vascular and ependymal cells within the medulla of a sudden infant death syndrome case with confirmed neuroinflammation and occult human parechovirus 3 infection [Ramachandran et al. DOI:10.1001/jamaneurol.2023.5387].