Basic Information

Symbol
IFITM3
RNA class
mRNA
Alias
Interferon Induced Transmembrane Protein 3 DSPA2b Dispanin Subfamily A Member 2b 1-8U Interferon-Induced Transmembrane Protein 3 Interferon-Inducible Protein 1-8U Interferon Induced Transmembrane Protein 3 (1-8U) IP15
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Sudden unexpected death diagnosis

MANE select

Transcript ID
NM_021034.3
Sequence length
611.0 nt
GC content
0.5810

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-191.40 kcal/mol
Thermodynamic ensemble
Free energy: -201.96 kcal/mol
Frequency: 0.0000
Diversity: 163.65
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........((((.(((.((..(((.(((((((.....((((((...((.....)).))))))..............(((....))).)))))))...(((.....((((.((.....((((((((((((((.((((((.((((((.((...........)).))))))(((.....)))..........))))))...)))).)))))..(((((.......)))))...(((((............)))))...........(((((..((((.(((((....(((((.(..((..((((..(((((...((((((.((((((..((((((((.(((((((((((((((......)))......((.(((((...((((..((((((...............))))))..)))).)))))))(((((((((((......)))).)))))))))))))).....))))).)).))))))................))))).).))))))....)))))..))))))..)))))).))))).))))...)))))....)))))....)).)))).....)))...........)))..)).))).)))).
Thermodynamic Ensemble Prediction
..........((((.{((.,({{({,.,,|||||...||((((((...{(...,,|,.}}}}}}..............{(({,,,|||.||||||,........,.{(({{,{||},.|{,((,((((({(((,({((({.{(((((.((...........)).))))))|||.,,,,)|||...,.....}})))),.,}))}.,)})),|(((||.,,,}.)))))).,,||{{{............}))}}....},,,|,.(((((,,((((.(((({....{((((.|..||,|{(((.,{((({,,.((((((.((((((..((((((((.(((((((((((((...,,...},},.....{{.(((((...((((..((((((...............))))))..)))).)))))}},((((((((((......)))).)))))))))))))).....))))).)).))))))..,,.,....,,.,..))))).).))))))....})))).,)))})}..,))))).))))).)))}...}))}).............}},.,.,.....,|(((({......})))).)),))}.)))).

Transcripts

ID Sequence Length GC content
GAGAACCAUCCCAGUAACCCGACCGCCGCUGGUCUUCGCUGGACACCAU… 611 nt 0.5810
Summary

Interferon-induced transmembrane (IFITM) proteins are a family of interferon induced antiviral proteins. The family contains five members, including IFITM1, IFITM2 and IFITM3 and belong to the CD225 superfamily. The protein encoded by this gene restricts cellular entry by diverse viral pathogens, such as influenza A virus, Ebola virus and Sars-CoV-2. [provided by RefSeq, Nov 2021]

Forensic Context

A study in mice demonstrated that the IFITM3 was identified as a hub gene in a microglia-localized, 72-hour post-withdrawal gene module positively correlated with ethanol consumption, indicating its association with drinking escalations in alcohol-dependent animals [Grantham et al. DOI:10.1016/J.Neuropharm.2023.109768]. In human infants, interferon-induced transmembrane protein transcripts, including the IFITM3, were significantly enriched in vascular and ependymal cells within the medulla of a sudden infant death syndrome case with confirmed neuroinflammation and occult human parechovirus 3 infection [Ramachandran et al. DOI:10.1001/jamaneurol.2023.5387].