| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGAACCUAGAGCCCAAGGUUCAGAGUCACCCAUCUCAGCAAGCCCAG… | 878 nt | 0.4453 |
This gene is a member of the alpha interferon gene cluster on chromosome 9. The encoded cytokine is a member of the type I interferon family that is produced in response to viral infection as a key part of the innate immune response with potent antiviral, antiproliferative and immunomodulatory properties. This cytokine, like other type I interferons, binds a plasma membrane receptor made of IFNAR1 and IFNAR2 that is ubiquitously expressed, and thus is able to act on virtually all body cells. This cytokine is upregulated in preeclamptic placentas and is thought to be a mediator of preeclampsia. [provided by RefSeq, Aug 2020]
A study in pigs demonstrated that the IFNA1 gene was downregulated in bruised subcutaneous fat tissue over time, showing decreased expression at 2, 5, and 8 hours post-infliction relative to uninjured control tissue [Barington et al. DOI:10.1016/J.Jflm.2018.06.005]. This expression pattern was part of a broader inflammatory gene signature where combining histology and mRNA expression of 13 selected genes, including the IFNA1, enabled the determination of bruise age with a precision of ±2.04 hours.