Basic Information

Symbol
IFNA1
RNA class
mRNA
Alias
Interferon Alpha 1 IFN-AlphaD IFN-ALPHA IFNA13 IFNA@ IFL IFN Interferon Alpha-1/13 Interferon Alpha 1b Interferon Alpha-D IFN-Alpha-1/13 LeIF D Interferon Alpha-1 Interferon-Alpha1 IFN-Alpha 1b
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_024013.3
Sequence length
878.0 nt
GC content
0.4453

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-248.10 kcal/mol
Thermodynamic ensemble
Free energy: -262.38 kcal/mol
Frequency: 0.0000
Diversity: 171.67
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((........)))))).((((((......((((((...(((..((((...((((......(((.....)))....))))..))))..))).(((((((((((.(((..(((..(((((.(.((((((((((((((.((((...))))..)))))))))))......))).).))))))))..)))))))....((.((((.....((((((((((((((((.....)))))..(((((((((((..(.((((((((....((((((....((((......))))...))))))....)))))).)).)..))))))).)).)).......(((((......))))).(((((.((((((.((...(((..(....((((.....))))....)..)))..)))))))).).))))((((.(((..(((.((((....((((((((((.(((((...))))).((((.....((((.....((((.......))))......))))....))))...(((.(((((((..........((..(((........)))..)))))))))..))).(((....))))))))))))))))))))..))).))))........)))))))))))......)))).))....((((...((((....))))..)))).)))))))....((.....(((.....(((........)))..))).....))..............)))))).....))))))....((((((((.(((((..........))))))))))))).......((..((((((.(.(((((......((((((((....))))))))....)))))..).))))))..))..
Thermodynamic Ensemble Prediction
...((((((.,......)))))),(((((,.,,,,,,{((((,{.,((,,{{{{,,,|{{,.......||.{{{...)}}..)))),.}}}},,))).(((((((((((.(((..((,.,(((((.(.((((((((((((((.((((...))))..))))))))))}.....,))).).))))))))..)))))))....((.((((.....((((((((((((((((.....)))))..,.,,{((((((..,.((((((((....((((((....((({......))))...))))))....)))))).)).}..))))))).,|{||,,.....(((((......))))).(((((.((((({,((...(((..{....((((.....))))....}..)))..)))))))).),})))((((.(((..(((.((((,...{(((((((((.(((((...))))){(,(({,..,{{(,..,,.{{{{{({,{{{{{{.....}}))}}.....,,..{{(((.{{{{{{|},,,......||,,||{.,.,,,,.)))..}}))))))}}}),}..}}}}.})..)))))))))))))))))..))).)))).,,,,,,.)))))))))))......)))).))....((((...((((....))))..)))).))))))),....,.....{||,....|||},......))),,}.......},......,,,|,...,}},||{{{,.,,|}))|,,.{{((((((.{{{||..........)))}}}}}))}}}.......{{..((((((.{.(((((......((((((((....))))))))....)))))..,.))))))..))..

Transcripts

ID Sequence Length GC content
AGAGAACCUAGAGCCCAAGGUUCAGAGUCACCCAUCUCAGCAAGCCCAG… 878 nt 0.4453
Summary

This gene is a member of the alpha interferon gene cluster on chromosome 9. The encoded cytokine is a member of the type I interferon family that is produced in response to viral infection as a key part of the innate immune response with potent antiviral, antiproliferative and immunomodulatory properties. This cytokine, like other type I interferons, binds a plasma membrane receptor made of IFNAR1 and IFNAR2 that is ubiquitously expressed, and thus is able to act on virtually all body cells. This cytokine is upregulated in preeclamptic placentas and is thought to be a mediator of preeclampsia. [provided by RefSeq, Aug 2020]

Forensic Context

A study in pigs demonstrated that the IFNA1 gene was downregulated in bruised subcutaneous fat tissue over time, showing decreased expression at 2, 5, and 8 hours post-infliction relative to uninjured control tissue [Barington et al. DOI:10.1016/J.Jflm.2018.06.005]. This expression pattern was part of a broader inflammatory gene signature where combining histology and mRNA expression of 13 selected genes, including the IFNA1, enabled the determination of bruise age with a precision of ±2.04 hours.