Basic Information

Symbol
IFNB1
RNA class
mRNA
Alias
Interferon Beta 1 IFB IFNB IFF Interferon, Beta 1, Fibroblast Fibroblast Interferon Interferon Beta IFN-Beta Interferon-Beta
Location (GRCh38)
9:21077104-21077942
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Sudden cardiac death diagnosis Sudden death from CNS diseases Mechanical injury analysis Wound age identification
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_002176.4
Sequence length
839.0 nt
GC content
0.4172

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-224.00 kcal/mol
Thermodynamic ensemble
Free energy: -242.47 kcal/mol
Frequency: 0.0000
Diversity: 261.16
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.............((((((((((....((((..(((((((((((.((((((.(((((((((((((((...)))))))...)).)))))).))).......)))..)))))))))))..........(((((.......)))))....(((..(((........)))..))).(((((((((((((.(((((..(((((((.........)))))))((((((...((.(((((.((....((((........))))))))))))).)))))).((....))((((((...((((.....((((.((((((((((...))))).(((((....((((((...(((((((((((..((((((((((....))))).)))))....))))((((((((((((...((((((((.(((((((((.....))))))((((.((.(..((.......((((.((((.....)))).))))........))..).)).)))).....)))..)))))))).)))))).)))).))....))))))).))))))((((((...))))))))))).....))))).))))...))))..))))))...................(((((((((.....................)))))))))..))))).)))))).)))))))...))))..))))..(((.(((..(((.....)))..))).)))...((((...))))..)))))).(((((((((.(((((((((.....((((((.(((((.....)))))..)))))).....))))))))).........)))))))))..........
Thermodynamic Ensemble Prediction
..,{{,..((,..(((((({,(((....}}},.(((((((((((.((((((.(((((((((((((((...}))))))...)),}))))).))).......)))..)))))))))))....,.....(((((.......))))).....,((((({,...........,}}}}||{{{{{(((((({((({(.,({{{{{{|||..,,,.}}}||||(({{{,...{{,||||,.{,.,,(((((........)))))}))}))))}}}}}||,{,{{{,,{(((((({{.{(((((,..((((.((((({{(((...}}}}}.(((((....{((((({,.,{((((({(((,.((((((((((....)))))},)))).,,.}}))||(((((((((({..((((((((.{{.((((((.....))))))||||.{{{{{{{........((((.((((.....)))).))))|,.....,}},.|.||,}}}),,...}}}..)))))))),)))))).)))).},....))))))),}))))}((((((...))))))))))).,...))))).))))...))))..|||,,,.....}},.......,...{((((((({..............,..,...))))))))))})))))}))))}|,}}}}}}},|,||||.,|,|,,.,(({({,..|||},,..}))}.,}),,))},.,|||.,,))},..)))))).}},)}))}|,,,,{{{,,({{.{{{{(((..{{((,,{{{{{{{||,,,{,{|||....,.,}},)))))))}.,}}}.))))))),),,..},,.

Transcripts

ID Sequence Length GC content
NM_002176.4 NCBI
AUUCUAACUGCAACCUUUCGAAGCCUUUGCUCUGGCACAACAGGUAGUA… 839 nt 0.4172
Summary

This gene encodes a cytokine that belongs to the interferon family of signaling proteins, which are released as part of the innate immune response to pathogens. The protein encoded by this gene belongs to the type I class of interferons, which are important for defense against viral infections. In addition, type I interferons are involved in cell differentiation and anti-tumor defenses. Following secretion in response to a pathogen, type I interferons bind a homologous receptor complex and induce transcription of genes such as those encoding inflammatory cytokines and chemokines. Overactivation of type I interferon secretion is linked to autoimmune diseases. Mice deficient for this gene display several phenotypes including defects in B cell maturation and increased susceptibility to viral infection. [provided by RefSeq, Sep 2015]

Forensic Context

A study in mice demonstrated that myocardial infarction (MI) activates the IFNB1 gene in cardiac macrophages, particularly in post-phagocytic cells, driving a detrimental type I interferon response that worsens survival and cardiac function [King et al. DOI:10.1038/nm.4428]. Another study in mice showed that traumatic brain injury (TBI) induces upregulation of the IFNB1 gene in meningeal macrophages at one week post-injury, contributing to a type I interferon signature [Bolte et al. DOI:10.7554/eLife.81154]. A study in rats demonstrated that blast wave exposure induced upregulation of the IFNB1 mRNA, a marker for fibroblast proliferation, which was elevated at all time points after 10-11 psi and 14-15 psi exposures [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001]. This expression pattern was part of a coordinated vascular wound healing and inflammatory response, correlating with histopathological findings of venous hemorrhage and thrombosis in the brain.