Basic Information

Symbol
IFNG
RNA class
mRNA
Alias
Interferon Gamma Immune Interferon IFN-Gamma IMD69 IFG IFI
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Cause of death analysis

MANE select

Transcript ID
NM_000619.3
Sequence length
1211.0 nt
GC content
0.3576

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-274.60 kcal/mol
Thermodynamic ensemble
Free energy: -302.19 kcal/mol
Frequency: 0.0000
Diversity: 397.69
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((.((((.......))))(((((..(((((.((((((((((....((((...))))))))))..((((...)))).........))))..))))).)))))...(((..(((....))).))).....((((......))))(((((((.(((((((((.((((((((...(((((((.......))))))))))...(((.......))).......((((((....)))))).(((.(((.....))).).))......((..(((((((((((...((.(((...))).))..)))))))))))..))..))))).))))))))).....(((((((((...(((((.(((((((............((((.......))))..))))))).)))))......)))).))))).....(((..((((((..............))))))..)))((((((((((((((((((..((.((((.(....(((......)))....((...))..............(((..((..((((((..(((....)))))))))..))..)))).)))).))..)))))...))).)))))))))))))))))....((((.(((((((((......((((((((((..........................................((((((((((((((((..((((.((((((..((...((((.............))))...))...)))...)))...))))..))))))).............)))))))))...(((((((..((((.((...((((((((...........)))))))).)).))))......((((((......))))))......(((..(((((((.(........).)))))))..)))((((((((((((.(((............))))))))))))))).......)))))))(((.(((..........))).))).(((((((((.........))))...)))))..........((((((((((....))))))....))))(((((..((((..........)))))))))..)))))))))).))))))))).))))....(((((((........)))))))...........................)))))).(((......))).....
Thermodynamic Ensemble Prediction
.({(((((({{,{(,{{{{{{||||{((((,,(((((.,,.,((((((,...((((...))))}}}}}}..{{{{,..}}}}....,}}}}}}},..})))).))))}...,||,.(((....))),|||,....{(((.,...,||||{.{||||.((((({{,{{((,,((((({,{,{((((.......))))))))))).,}}....}},.)),}}},,.,,{||||....})))}}|{{{||||.||||)))},.||}|,|},|(,.(((((((((({...((.{{,...}}}.}},.)))))}}}}}|.,||,..||||,,|||||,||.....((.((((((((.{{{{....,,{{{,,....|||,,,((((......,))))...,,}.{((({{{|{,..(((((..((,,.((((((((,,(((((((...,{{{.,............}.)).}},.))))))))))).....))))),,..))..))))).,}))}.,)))...........,,....|.{((..((..((((((..(((....)))))))))..))..))),}.,.)))))))).))((((((.{((((....))))})))))),(({,.,|||{{{{{..,,,,|||{||||{(,,,.,{{,,,.,,,,...,,,,,..,|,},,},....,....((((((((((((((((..((((.(((({{.,({...{{((..,,,....,,..}}}}.,,))...))}..,)))...))))..))))))).........,,..))))))))).,|||{|,|,|,||{|.{,..,{{{{(({{,{{,,....,,})}}|}||,|,,||}}..,},.||||||...,,,||||||...,,{(((,.(((((((.{........}.))))))).{|||{{((((((((({,(({............})))))))))))))}|}}..,,,||}},}|||.{||}||,....,,))),)}}.{{{({{{|,.{|||....,)))}}}))))),,,,|||,|,,,||{{((((....)))))),...,}},{(((,,,{(((........,.)))))))))..}}}}}}}}}|,|||||}}|}.|}}}...,({{{{||...,,...}))}))),,,....,,,,,|{{|.....,,,,.,}}}}},.|||,.,},,},,.....

Transcripts

ID Sequence Length GC content
ACAUUGUUCUGAUCAUCUGAAGAUCAGCUAUUAGAAGAGAAAGAUCAGU… 1211 nt 0.3576
Summary

This gene encodes a soluble cytokine that is a member of the type II interferon class. The encoded protein is secreted by cells of both the innate and adaptive immune systems. The active protein is a homodimer that binds to the interferon gamma receptor which triggers a cellular response to viral and microbial infections. Mutations in this gene are associated with an increased susceptibility to viral, bacterial and parasitic infections and to several autoimmune diseases. [provided by RefSeq, Dec 2015]

Forensic Context

A study in mice demonstrated that the transcription factor E2F3b in the prefrontal cortex is critical for cocaine-induced locomotor activity and conditioned place preference, with its overexpression driving a transcriptomic profile similar to cocaine self-administration and enriching for oligodendrocyte markers [Cates et al. DOI:10.1038/s41386-018-0296-1]. In rhesus macaques, the IFNG was identified as a top upstream regulator of genes differentially expressed in non-survivors of radiation-induced lung injury, highlighting its role as a key inflammatory mediator in this pathology [Thakur et al. DOI:10.1016/j.ijrobp.2021.03.058].