| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAUUGUUCUGAUCAUCUGAAGAUCAGCUAUUAGAAGAGAAAGAUCAGU… | 1211 nt | 0.3576 |
This gene encodes a soluble cytokine that is a member of the type II interferon class. The encoded protein is secreted by cells of both the innate and adaptive immune systems. The active protein is a homodimer that binds to the interferon gamma receptor which triggers a cellular response to viral and microbial infections. Mutations in this gene are associated with an increased susceptibility to viral, bacterial and parasitic infections and to several autoimmune diseases. [provided by RefSeq, Dec 2015]
A study in mice demonstrated that the transcription factor E2F3b in the prefrontal cortex is critical for cocaine-induced locomotor activity and conditioned place preference, with its overexpression driving a transcriptomic profile similar to cocaine self-administration and enriching for oligodendrocyte markers [Cates et al. DOI:10.1038/s41386-018-0296-1]. In rhesus macaques, the IFNG was identified as a top upstream regulator of genes differentially expressed in non-survivors of radiation-induced lung injury, highlighting its role as a key inflammatory mediator in this pathology [Thakur et al. DOI:10.1016/j.ijrobp.2021.03.058].