Basic Information

Symbol
IGF2R
RNA class
mRNA
Alias
Insulin Like Growth Factor 2 Receptor MPRI CI-M6PR CI-MPR MPR300 CD222 CIMPR M6P-R MPR1 Cation-Independent Mannose-6-Phosphate Receptor Insulin-Like Growth Factor II Receptor Insulin-Like Growth Factor 2 Receptor 300 KDa Mannose 6-Phosphate Receptor CI Man-6-P Receptor M6P/IGF2 Receptor IGF-II Receptor M6P/IGF2R MPR 300 Cation-Independent Mannose-6 Phosphate Receptor CD222 Antigen M6PR
Location (GRCh38)
6:159969082-160113507
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Time since deposition estimation Other applications
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_000876.4
Sequence length
14061.0 nt
GC content
0.4943

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-4780.60 kcal/mol
Thermodynamic ensemble
Free energy: -5037.46 kcal/mol
Frequency: 0.0000
Diversity: 4201.56
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((.(((.(((((.(((((((((((..((((...))))..)).))))))..((((.((((((.(((((.((..((((..(((((.(((...........(((((((((((((.......(((((((...(((((((((.....)))).)...)))).))))))).))))))))).))))((((((.(((((.....)))))))).)))))))))))((((((.((.((((((.(((((.((((.((((...(((((((((((((((((((((((((((((((...((((.((...((((((((.((((.(((((..(((((....((.(((((((........................))))))).))......)))))...))))).)))).))))...((((((..(((......)))..))))))....((.((((........)))).))((((((((...((...((((..((((.......)))).......(((....))).((((....))))...))))...))))))))))..)))).))...)))).)))))))))....)))))))).............(((..((((.((.....)))))).)))....(((((....)))))))))).(((...(((......)))...)))...(((.(((((((..((((...(((((((..((((((((((........))))))..)))).))))))).))))))))))).)))(((((.((((((((((((((((...(((((((............)))))))........((((((...((((((((((.((((((...((((...(((((.((.(((((...((((((((........)))))))).....(((..((((((..(((......)))..))))))..)))((((((....)))))).......((((((((.((((..(.((((((((((...((((((((((((.((...)).))))))))))))...)))).(((((((..((((((...(((.......)))....((((((((...(((((((((.(((.(((..(((((.((.(((((..(((..((((...))).)..)))......)))))...(((((((....(((((((((.((((..(((((((((((((......((.(((.....))).))(((.....)))....(((((((((((.(((...))).))))))))))).)))))))))).(((((.....)))))............)))..)))).)))))))..)).....)))))))..)).))))).))).))).)))).......((((..........(((((...)))))((((((..(((((((.(.......).)))))))....((((.((((((((((..(((......)))...)))))))))))))).......(((((((((((.(((.....((((((..(((....(((((((((((.......(((.((((((.(((((((...((.....))))))))).)))))).)))..)))))))))))(((..((.((...))(((((((.(((.(..(((((...((((((.(.(((((......(((.(((...........))).)))))))).))))).))...)))).)..).))).))))))).......((((((.((((((..((((((((((((((((...(((((((((((.(((((.((((...(((((.(((((((....((((.((((((((((((((((.....)))))).((((((((((((((...(((...)))...)))))..))))..))).))....((((((..(((..............)))..))))))((((((.(((((((.(((((((((....((...((((.(((...)))..)))).((((((....))))))....((((((((((...((((..(((((((.(((((((((...))))).(.(((((((((((((........(((((((((((...(((((((((((...........))).))))))))....)))))....((((((((.(((((.((((((...))))))...((.(.(((((...((.((.((..(((((((..(((((((((((((..((((((....))))..((((.........))))))..)))))))))).((((((.(((...))).))))))(((((((((((((.((((.....((((((((((((((...............((((....((..(((...((((((((((........))))).))).))..(((((...(((((((((...)))))..))))...)))))..........((((.(((((.(((((((((((....((((.((...))))))...)))))).........((((((.(((((((.((......)))))))))..(((...(((....))).))).))))))...))))).)))))))))...)))..)).....))))..((((........))))......))))))).)))))))....))))(((((((((((((((((....))))).))))(((.(((((..(((......)))......))))))))..((.(((((((.........))))))).)).......))))))))(((((..(....)..)))))(((....)))...((((.(((((((.(.((((.............)))).).)))).)))....)))).)))).))))))))).))).)))))))..)).)))).))))).))))))))..)))))))))))))))))))))...)))))).)....)))).))))))))))).)))))))))).))..))))).)..))).)))))))..))))))...((((((.((((((((.............)))))))).........((.(((((.....))).)).)).)))))))))))))))).)))).))))))).))))).))))))))).))))).))))))(((.....(((((((.......)))))))...)))....(((.....))).....((((...((((.((((...((........))...))))...))))))))(((((..........))))).(((....))))))).....))))..(((..((.((((......(((((((.((.......))...))))))).....))))))..)))....))))))))...........))))))))))))))..))).......)))...))))))....))))))).))))))).....))))))))))...((((.(((...))).))))...............((((((((((....)).)))))))).....))))).))))).)))...)))))))))))))((((((....)))))).....))).))).)...))))))))))))....((((...))))))))).)).).))))(((.((.....)).)))))))..))))))))))))))))))))))...(((((((.(((....((((.((.(.(((.((((((((.(((.....((((..(((((..(.(((((((.......))).)))))..).))))..))))))))))))))).))).)..)).)).))...(((((((((((((((((((.......((((..(((((((..((((((..((..((.((((.((((.((((((((((((...(((((.(((.....)))..(((((((........)))).)))((.(((....))).)).((((.....))))(((((((((.((((...(((((.........(((((.((((....)))).)))))((((.((((..((((((((((.((((((......)))...(((((((...((((...))))...((((((((...))))..)))))))))))(((.(((....))).)))...)))))))))........))))....)))).)))).......))))))))).))))))))))))))...)))))))))))).)))).)))).))...))(((((............(((((((((((((((((((((((....)))))).))))).(((.((((.((((..((((.((...(((.....)))...))))))...)))).))))))).(((((..((((((((((.((...(((.((((....))))....)))...)).))))))))))...)))))...............))))).))))))))))))))))))...(((((......))))))))))))))))((((..(.((((((((((...(((..((((((........)).))))...)))...))).))))))).)..))))))))))))))))))....)))))))).))))))))))).....))).)))))....)))).))))).......((.(((.(((((.((((((((((..((((((((.(.((.....))).))).)))))..((((((((((((((.(((.((((.....))))...(((.(((..((.((((((((((((.((.(((((....))))).))...(((..(((((...))))))))...((((((((....(((((((((((((((((...((((....))))((((.(((((((((......(.((((((((.(((((((.(((....((((.((......))))))((((((.(..(((....((((.(((((((((..((((.......)))).......(((.(((((.........))))).)))..(((.(((.(.....).))))))......((((((.(((...((.((.((..((......))..)).))))..))))))))).........))))))))).))))..)))..)))))))............)))))))))).)))((.(((...))).)).(((((((((((......((((((.....))))))........)))).)))).))).((((((((.(((((..(((.........)))..)).)))))))))))..))))))......)))))))))..))))...........(((((((........((((((((..(((((((..(((((.((.((((..(((((...((((((((.(((((.(((((((((....(....)....))).....)))))).)))))((((.............))))........))))))))...))))).)))).......))))))).)))))))...((((((((.((....(((......))).)).)))))))).)))))))).(((((..((((........)))).)).))).....((.(((.....))).))....((((((((((((.((...)).))))))))))))......)))))))(((((((.(((((((((((((((..((((((..(((......(((((((((...))))).))))((((((((((((((.((....))))))))))......).))))))))..).)))))))))))))).(((((((....)))))))(((((.((((((..(((((((...(((.((((((((((.(((.......(((.....))).......)))...)))))))))).)))...(((.(.((((..((...........)).)))).).)))..)))))))))))))..(((............))).)))))...))))))))).))))((((((.(((((..((((((((((((((....(((((.....)).))).......(((((..((....))...))))).....))))).((....))..((((((((....))))))))....(((((((.(((((...)).))))))))))........(((((((.((.((((((((((..((.....))..))).))))(((.((((((.....)))))).)))..(((.....))))))))..)))))))))).))))))))))).))))))....))))))))..)))).).))))...)))).))))...((((((..((((...))))...))))))...((((....))))))))....((((((((((...((((.((((((.....(((......)))))))))(((((((((((.(((.((((.....((.((((((((((((((.....)))))))((((....((..(((((((((((((.........)))))).....)).)))))..)).....)))).((((.(((((.(((((((.........)))))))..........(((((((((......(((((.((....)).))))).(((((((.(((....)))...))))))).((((((.((....)))))))).((((((...(((......((((((((((((((.............(((......))))))))))).).))))).))))))))).........(((..(((.(((((((((((..........((((((((.((.....))..))))))))............(.(((((..(........)..))))).).)))))))))))..)))..)))..................((((.(((((.(.((....)).).)))))))))....))))))))).(((((..((((...))))..)))))))))).))))......))))))))))))))))..))))))).)))).......((((....))))((((((((((.(((((.........))))).......((((.(((((.((((((....(((.....))).....)))))))))))))))((....))......((((.(......).)))).))))))))))(((.(((.((((.....))))))).)))....))))....)))))))))))))))))).))....))).))).(((((((((.....((((((.......))))))((((((.(.((....)).).)))))).........((((((((..(((((..(((((((((((((...(((((.(.(((((((.((((.....)))).(((((((((((.(....))))..)))..)))))......((........))...(((((((((((.((((.(((((((((((.((((((((..((((((............))))))..))))))...(((((....))))))).))).)))))))))))).((.(((.(((((((.(((.......)))......((((((....)).))))..........))))))))))..))(((((((((((((((.(...(((((((((....(((((...)))))(((..(((((.(((.....((((..(((.......)))..)))).....)))...)))))...)))..((((((((...)))).)))).....((((..((.((....))..))..))))..........))))))).))...)..)))))......)))))))))).((((((((((((......).)))))))))))...((((((((((((...((.(((((((((....(((....((((((....))))))..)))....))).(((((......)))))..((((((.((((((....)))))).))))))..............(((((((((((.((((.(((.(((........))).))).)))).......))))).))))))...(((....)))...))))))))...................))))))))))))..))))))))))).........((((....))))................)))))))))))))((((.((...((((((..(((((.(((((((((..(((((((.....(.(((((((((.........))))))))))..))))))).))))))))))))))......)))))).)).)))))))).))))))))))))))..))))))))))))))))).(((((.((((((((((((((((.((((((((((((((((((((((..((...))..))((((((((((.(((((..(((((.(((((..((.....))..))))))))((((......)))).))..))))))))))))))))))).((((((((..((((..(((((((..(((.(((...........))).))))))))))))))..)))))))))))))))))))))))).))))))))))))))))(((((((....((((((((((((..(((.........(((..(((((......)))))..))))))..))))).)))))))..)))))))...((((......)))).....((.(((((........))))))).......))))).....))).)).)))).)))))))).......((((....))))(((((........)))))........))))))).))).))))).)))))))).))))))...))))))))))))).))))))))...))))))..)))).)).)))))..)))))).))))))).)))))..(((((((((((((((((((((((...............))))))))))))..((((.((((...(.(((......))).))))).))))..........(((((((((((((......(((.....(((((((...((((((........).))))).))))))).(((((((((((.((((..(((((.((((((((((.....(((((((.(((.((((((((((((.......((((((........))))))......(((((..(((((........))))))))))(((...)))......((((((((((.((((......((.(((.((.........)).))).)).....)))).)))))))).))((((..((((......(((((((((.....((((.(((.....).)))))).....)).......)))))))..(((((....(((((......(((((((......(((.......)))........)))))))......)))))...)))))))))..))))(((((((((.(((((((.......)))))))((((........))))(((.((((....((((((((((((....(((((((((.(((((((((.....)))))((((....))))((((((...............)))))).....((((((((((.(((((......))))).)))).)).))))........(((((((.(((((((((...((((.(((....(((((..((..((((((..(((.........)))....((((.................(((((((...((((..................))))...))))))).((((....)))).))))......((((...................)))).....((((.(((((((((((((((((((.((((((((((......(((((((((((((.(((((.(((...((((.(((((((((.((((....))))))))....((((....))))...))))).)))).))).))).)).....(.(((.(((.((((((((((.(((((((((....((((.(((((.((((((.((..(((((((...(((......)))...)))))))..))..((((.(((((...((((((((((.((((..(((.((......(((((((((.((((...............))))..)))))))))......)).)))))))))))))))))...((((((((....)))))).))...))))).))))((((..(((((......(((((.(((((((.((((((....((((..((.....))..)))).....))))))..))))))).)))))))))).))))...)))))).....(((..(((((......)))))..))).(((((((.........)))))))...(((((......)))))..................(((.......(((.(((((.....)))))))).......))).)))))..)))).......(((.(((...((((((((((((((((((.....(((((((.((((..(((((..((((((.(((...((((.(((((((((.......))))................))))).(((((((((......(((((...(((((((..((.((..(((((..((((......))))..)))))..))))..)))(((..((((......))))..))))))))))))....))))))))).)).))...))).))))))..))))).(((....)))....((........))......)))).)))))))((.(((....))))).............(((.......)))..(((.(((((((((((....).)))).)).))))))))))))).....))))))))))))..))).)))..)))))))))))))))))))..))).))).).(((.(.(((......))).).))).....))))....)))))))))(((((.((((..(((.(((((((((.(((((....((.(((.((((((((((((((((((((.............(((((....((((((...))))))...)))))((((((((........((((((((((....((((((((((((((((.(((((..(((.((........(((((((((((((.(((((....(((.((.(((((((....)).))))))).))).((((((((((....(((((((((..(((.........)))...)))))))))......................................................................((((........)))).)))))))))).........((((.(((((((((((((.((....)))).)))))))..))))))))(((........))).))))).)))).)))))))))...((((((((......((((.....))))...))))))))...................(((((.(((...))).)))))))..)))..))))).)))..((((((......((((((((((((((...))))..(.((((((......(((....)))......))))))).(((((.((((((...)))))).)))))...)))))).)).))..))))))...........)))))).))))))))))))))))).......))))))))((((((((..(.(((........))).).....))))))))..((((.((((((.....))))))..((((.((((.(((((((((((((((((((((.((((((((..(((((((((........))).((((((((((((((((.((((((.(((.(((((((.((........)))))))))..)))(((((((((.((((........))))..)))))).)))...)))))).)).))))..((((........))))....(((((((......)))))))))))))))))......(((((((....((..((((((.((((.......(((((((((...))).....)))))).....)))).))))))..)).....)))))))))))))...)))...)))))((((......(((....))).......)))).....((((.((((((((((.(((.((....(((((...))))).)).)))...)).......)))))))).))))...)))).))))))).....)))))..))))).)))).)))).))))))))))))))))))....))))))..)))..)).......))))).)))))))))((((((......))))))...)))))))(((((((.......))))))).......))))))))))....))))))))))))))))...((((((.......))).)))....)))).)))))))))))))).))..)))))..(((((....)))))...(((((((((((((..((((.((....(((((..((((((.((((((....)))))).((((....))))....)))))).)).)))...)).)))).)))))............))))))))......))).))))..)))).))))).)))))))(((((.((((.............)))).)))))..)))).)))....)))).))...))))))))))))..)))))))..(((....)))..........(((((.(((.((((((((.(.(((((((...........))).)))).)..))))))))..))).)))))...(((((((((((((((...))))((((((((.(((.(((((........))))).))))))))))).......))))))))))).......))))))))).(((((((.((((((.((.......(((((........)))))..)).)))))).)))))))(((.((((((............(((((.......))))).(((((((.((((((((.((((........))))((((((((..((.....(....).....))..)))))))).((((...))))................)))))))).)))....))))..(((((((....................))))))).(((....))))))))).)))))))))))))))((((((.........((((..(((..(((((((((..(((..(((((......))).)))))))))))).....))..))).))))))))))......))).))))))))))))))))).))))).....(((.....))).....(((.((.(((((((.(((((....))).)).)))))))..)).)))...((((((.......))).))))))).)))))))))))...))).......))))))))).).)))(((......)))((.(((((.....))))).))......((.((((((...(((((((.......((((.(((((((.(((.(((.(.(((.((.((.(((.(((((((..((((((..((((...))))..))))...(((....))).((((((((((((((.....(((.(((((((.((.............)).))))))))))..((((((..((.(((((((........)))........)))).)).))))))......((((.....)))).((((.....))))..(((........)))...))))))))))))))................(((((.........((((((....)).))))))))).((((...(((((..........))))).)))).....))..)))....)))).))).)).)).))).)))).))).))))))))))).......)))).)))..)))))).)))))))))))))...((((.....))))..(((.((((...((((...((((((.((.............(((((((.....)))))))...)).))))))...))))....)))).)))(((((.(((((((....)))))))...))))).....))).))....
Thermodynamic Ensemble Prediction
.{(((((((((((({((.((((((((..((((...))))..)).))))))..||...,,{,.,,((((.(((((((((,{(((((.(((...,||,..}}(((((((((((((......,{((((((...(((({((((.....)))).,...)))).))))))).)))))))))},)))((((((.(((((.....)))))))).)))}}||}|||,{(,((((((((((.(({(((((((((.{{(.(((((((((((((((..(((((((((((((((((...((((.{{...(({{((((.((((.(((((..(((((....((.(((((((.......,........,}}.....))))))).))......)))))...))))).)))).))))...{{{(((,,(((,....,|||,.}|||}|,|.{((.((((.,......)))).))}{{{{|{|.,|||,..||||,.((((.......)))).......{,,....|||,{{((,,.,|}}}..,)))),..))))}))))}..)))),)),,.)))).)))))))))....))))))))...((((..,,.(((({{(((,,{{....,}|||||{{{{,,,,(((((,,,,|}}||{{{{,.|||,..,,,......}}}...}}}..|{{(,{(((((({,,{{{...(((((((.,((((((((((........))))))..)))).))))))).}}))))))))}.))}|||(({{...{{{{,,})}||,.{{{{{{||,,,.{{.{(((((....)))))).)}.....||,|,||{.{{{|,,,...,.,||||((((((((...{(((...|||},,{(((((((........)))))))).....{({..((((((..(((......)))..)))))),,))),))))))))}))))))}})))}))},,)))),,.((((((...(({{(((...((((((((((((.((...)).))))))))))))...)))|||((,({...,},,.||,.|||},{{,{{|,}...,||{,(({..,,,,,..{{...}}}.,},....}))))),,,.}},)))...)))))).((((((.,{,......,|,....},,,.))))))))))))))))))))).}.,|((((((((((......((.(((.....))).))(((.....)))....(((((((((((.{{,...,)).))))))))))).))))))))))|(((((.....|||||.(((........)))))))))))))},.....(((...{(((......))))....))}..))))))))).(({......}))...{({(((((...))))).)).....(((((((.(.......).))))))).,..((({,((((((((((..(((......))}...))))))))))))))......(((,,(({....,{((({.......})))||..,{.(((((((((((.......(((.((((((.(((((((...((.....))))))))).)))))).)))..))))))))))),}|}}}.})),.}))(({({((.(({.{..{(((({{{{,((((.(.((((({{{{..(((,,,,....,}}}...,))})},))))).))))).))},.,))).}..|.})).)))))))........,,},)}.)))))))))).))..)))}})))..}|||{{((((,,.|||||}||||}}},,,||}||||,,,....,((({(((((,{{{{{{{{{,..,,,))))),.{{({{(({((((((...((,...}))...)))))}.,}}}.,|}|{|{({,({{(((({,(((,..,...,,,,....}}.,,}},||(((({{,({{{{((,(({{{{(({,...|{.||{{(({{{{{,{,,|,{{{{|{((,{(({{{{}|||||....((({,(((((((((((((....)||)))))))||{|,.,)))||,{{((({{{,{{({{{{((({{,{{(({{{(((((,,.(((((({{(({........,,.|||,|}|||||}..,,||}}|,,,,{{{{|||{|..,,,,||.||})}})}}},...{((,(((((((,{(((((,(((,,(({,{,,{,,((((((((((((..((((((....))))..((((.........))))))..)))))))))).}|..,|.,...(((((({.|||{{,,(((.((.,((..(({.....}}}}},.)).,}}}))}}},,..})))))),}}.|||||}.},|||}|||,|}||||||||||,|||||,.}}|,|{{,({{((,{{(((((((((...))))).,||||...||}||,||,....||||||||||{,.,,{{{{,.,{|,{|||,(({(({{(((({({.,{((,((((({{{{{{{((({(,(((((((({((......,||||||}..((((.....,({{{,(({{{({{{{{|...{||{{{.,||||{|(({,..{{,{{{||,,,||||{|||||||,....,||.||,,.,,||||,|{((|,,|||..,,))),||||{{(((((((((((....))))).)))}{{{,{{{{{,,{{{.....,||||||,,|||||{(||..|||(({((((..,,.....)))))}},|||.|{{,,|||||||{{{{,,.{({{{{|{{({{{{(((,,.,|||...,(((.{((((((.{,((((....,..,.|.,,))}),|.}}}),)}).},},|{(({|.....})))))|{{.{{||,(((.{(((({,.{|}}|{||||{.......,,.....)))),))).})),)))))))))).)}}}.,}}}}))))))))}||{|||,,|||||,..,,}|}},.,.,|||,|||||}|..|}}}}}||.,{||,,.((((((((.{.,......,..)))))))).....,,,,{{..||{{....,})),}}{||,||||}}||||}}}}}}.,}}},}))))},.|}})}.))))})))),}))))|||||||(({.....{{((((({,{{,,{|||||||...|||{,,{(,.,{{{((({,,...{{((,(((,,{.,{{{{.{({{{{..||,,...,|||},,.}}}},}}.|||,|}}}}},.,}.,))))|||{,,..,|||||{,|||,||||..||||.||{|||||{|||||{||{{{.||,,,,,,,))...}}}||||,,,,,|(((({,,|,,,..{{{||||{.,{,|{|..,,...}})}}))}})))}},,}}...||{{,...})))),,....|,||||||}|{{|,|||||||.{{{{{,||,{,{{{{.|((...}}}.})))||},..,|,|,....((((((((((....)).))))))))...{{||,,,,|,{{(((((({....})))))}||{{{,.,||||,({(((,,..,|||.||||{...,|||}||||{,....,{{{||}.,))))){||,|||{,|,||||||,|{|,}.{|{|.,,,)))).,))).))|}))).).}|}}.}}}...{((((((,,{{((((((((.....(((.((((((((.(((...,,(({{.,((((,,,({(((({{,,,..,},))},)))))..}.)))),,}))}))))))))))).))),,{(((({,({({{(({.......)))}}})})))))}.,.{(({..(((((((..{{{{{{.,({,|({.((((.((((.((((((((((((...(((((.(((.....)))..(((((((.{,...,})))).))}((.(((....))).)).((((.....))))(((((((((.{({,...{{{{{.......,.(((((.((((....)))),)))))((((.((((..{{(((((((({(({{{({(({.{{||...((((({,...((((...))))..|{{{{{{{(...}})}.|}}))))))))){,{,|{|||,.))}.,,....}))))))))........,}}}...,)))).)))).,,,,,,}}}))))}).))))))))))))))...)))))))))))).)))).)))).,,...))(((({,..........|{((((((((((({((((((((((....)))))).))))|.(({.((((.((((..{{{{.{{..{(({.,...},},}.)))})),||}}}).))))}||{({{{(.,((((((((((.((...(((.((((....))))....))).,.)).))))))))))...}))))......,,,......))))).))))))))))))}}))))}}}((({{.....,)))))))))))))))}))))),...,,||||||{||}||,..{{{,,.......,||||||||||||||,}||||||||||}}|||..{(({,.,{||||||,|,...||}||,||||(((....)))|.{,,{({,.{{{({....,,,.....},,))))),|||||||||||,,,.}}|..}},..||||||||}|}|,}}}}.,,..)))})))}||.({((((((.,,{{,,.,{((((({,...||||,.{((({{{.{.{{{,{{{{...,,{{,{{.{{{{{,,,,|||||.,,...,,,..(((((...))))),)),}}}}.)))}.},,.)}))),)))}||||||}}}}||||}}}.))))}.}.}|||||||||,,||,,|.}},}}}}.||||((........}},|||{(({{{.{{||||||(((({{{(..(((....((((.(((((((((..{(({.{{{.(((({{((.((((((((,,(((({({.,.,..{{{.|,{{{{((,..,,...})}))),}}.)),.....)))))}.,|}}}..,.}|}}..}))})))}.))},}.{||||{.,,,)))))).........))))))))).))))..)))..)))))))...{{{{{{||{{{|||||||.{||,...))}|{||({,,{|{{|{{{(({,{{,...{((((,,..}}})))},,||},..,,}}},.,..(((((((...(({(.,{((({(((((((..{((.(..((((((((((((.(((.,,.............,,..))).)}}})).))))}.}}..}.)))))))))}..((((((((..(((((((..(((((.((.((((..(((((...((((((((.(((((.(((((({((,...,....,....))).....)))))).))))){{{(,,,,.........))}),,......))))))))...))))).))))..}}...)}))))).)))))))...((((((((.((....(,,.....,,)}.)).)))))))).)))))))).((({{..((((........)))).)).)))....,)))}..)))})))))))....((((((((((((.((...)).)))))))))))).,....{{{{||{{({{{({,(((((((((((((((..((((((..(((,.....(((((((((...))))).))))(((((,((((((((.({....})))))))))......}.))))))))..),}))))))))))))).|{{{|||,..,)))))))||||,}||||{(,,(((((((..|||{,|(((((((((.(((..,,...(((.....)))....},.)))...))))))))},.,}|,,,(,,...,{||}||,|,,|,|,|}..},.,}}|,}.})}},)))}|||||||||((((.,,.......,,.)))))))}}.,,}}))}}}}},)))),,,,||{||||||.||||((((({{{(.{{{{((({(({(,.,{,|||,{{{{.,(|(.{|{((..{{||||.|||{{{{{..,,{{{.,.({(((({{((((((((....))))))}}....(((((((.{(((,...)),,}}))))))).....,,}|,|||||}|..,|||,{,|||}}||},,.,{|....)})}))(((.((((((.....)))))).)))..,((,,...},,.,,....,,}}}))},))))))..))))},)}}}}}},||||}}}}}||}|,.,.}|||...,,{||{{{{,||,,,{{{{,..{{{|,,,})))...,}}},,.,||||{|{{{|(.{((,(({|.|||||{{(({{{{.},|,||,,|||...||||}|||,|}}}},|,|}|},.,,,....{{{{.{{|...))),)))),.{{.(((((((.....))))))).)},,{...,({(({{{|(((((((,,.......}))))}}.,,,{{{{,(((({..({{{((,(((,(((((((({{(((((((.,......,))))))).,,,,,.((((((.{........,.))))))((((((,{(((,,..(((((((.(((....)))...))))))).((((((((((((((({,,,..{((({.....((((..{(({..,(((....(((({....})))}..))))}}}.(((.(((((((((,{{((((..((((((((((,,(({..(((..(((.(((((((((((..........((((((((.((.....))..))))))))............(,(((((..{........}..))))).}.)))))))))))..)))..))).,.....(((((......((((.(((((.(.((....)).).)))))))))......)))))(({({(((..((((...))))..)))))))...,{({((((((((((.{,...,}}))))))))).,)||..(((((((((((((((..(((,((((((((((.(((((.........))))).,,{,.{(({(.(((((,((((((....(((.....))).....)))))))))))))))||.,,.},....}|((((.(......),)))).))))))))))|{.(((((..((((((({(.(((((({......,))}))).||(({((((.{(.((((.......|}|}|}.}}}}...||||....||||{|}},.,},)}}}}{((((((.{.((....)).}.))))))}........{(((((({..((({((((((((((((((((...(((((.{.(((((((,(((,.,...|||,.(((((((((((.{....))),.,))}.,)))}),,...}.,}},,....,|..,(((((((((((.((((.(((((((((((.,,((((((..((((((..{.........))))))..)))))).,.(((((....)))))),.)))))))))))))))).,,.(((.(((((((.(({....,}{|,,...,,..{||{(,,{,},.}}}),,,,......)))))))))),,||(((({{{((((((((.(...(((((((((..,{(((((...}||||.{...{{(((.(((.,...((((.,(((.......))),.))))...,.))).,,)}}}}...}}}|.{{{{{({(...}})).},)),)},.((((..((.((....))..))..))))..........))))))).))...}..}})))},....)))))))}},.((((((((((((......)}}))))))))))...(((((((((((({{{((,({{{{,{{{...,||||||.((((((....))))))..|||.,,{|||,{((((......))))}..((((((.((((((....)))))).))))))...{{,,...,,,.,{{{{{||||{.{|||,(({{(((......)}))}.))).}}}}.......})))).))))))}.,||{....|||,..,}}))))}...................))))))))))))..))))))))))),}.......((((....))))................)))))))}))))),{((.{(,..((((((..(((((.(((((((((..(((((((...,.(.(((((((((.........)))))))))).,))))))).))))))))))))))......)))))).)).)))})))),})))))))))))})}})))))))),.(((((({{{(|,(((((((,,((((,.(({.((((((((((((((((({(((((((....))...{((((((((((((((((..(((((.(((((..({.....)}.,))))))))((((......)))).))..)))))))))))))))}{((({(((((((..(((({.,{(((((..(((.(((...........))).))))))))))))))..))))))))}))))))))))))))))))))))))),)))|{(((((.(((.((((((((((((((..(((,........(((..((((,......)))))..))))))..))))).))),..)))))).))).)))))}|{((({...,}))},{{.(((((........))))))).((((....))))...,)))).))))))).)))},}}}})),,(((((....)))))})}}},((((((..(((((((((.((.....))...))))))).)))))))).)))))))..))))){{(((((((((.(((,{(((((((,{{.(.(((.(((..((((((.((.(((((((((({(((((({{{({,,..((((((((((((.{{..........}.)))))))))))))))).))))))}..))),.,{.({((((,,(((..(((((((.................)))))))))).))))))}}.})))))).)}.,).))))))..))).)))}.}}.(((.(((((((((((....,,...,|{{{,,,,,....{{{{,(((.........}}}.,},,.....,,,,,{{{{((........}}})))......{{{{{..{{{{{........))))}})))),((.((((.(((........))).)))).)).....))))))))))).))),)))))))))),))))))))))),)))..))))))))))))))).........))))))))))))))..)))}.|||((,.....,}},}},...))))))))).)))((((....(((((......(((((((.,,...(((.......)))...,,...)))))))......)))))...)))))))).....))))))))))))))))))))).......,,,.{{((({..{{{.|}...,{||||{.,..{{{.,,,|,||||||||..,{|.,,,,.}},||||({{,..|||||((({..,,|||,,,||||,,,,||||||.....,|||||.{{..{{{((({(((.(((((......))))).)))}.}},}}}}}}},,,,},||||||.,|,||||||...,|||}..|}}}}|,,,,......,,||||..||}}}}.....,)}}.,}}}}}}.................(((((((...((((..................))))...))))))).((((....))))..,,,.}}}}}))))}))}}...,,|,,....,,)))}......}}})}}})|}}||||||||,,,,.||||||||||}...,,||{{((((({{{{,,{(((.(((...((((.(((((((((.((((....))))))))....((((....))))...))))).)))).))).))),)),....,,|||.|||}||||||||||.|||||||||}}..{{||.|||||,}{||||,}||}||{(((....|||....}})))}},}|||||,,.{{{{({({.,{{{{...(((((((((((((((..({{.{(......(((((((((.((((...(({,...,)}}.))))..)))))))))......,,.})}))))))))))))))...,,{((({{{{,.||||||.|,...||||}.}||,|{{{|{.,|,,.....{(((({.(((((((.((((((....((((..((.....))..)))).....))))))..))))))).})))))))},.}))),,.)))))}.}},,}}}..(((((......)))))......(((((({.,,....,.)))))))....||||}.}}}}))))}))}})))).........{((...,}}..(((.(((((.....)))))))).......,}|,||}||,.||,,.......{{{.,{{,..{{{,(((((,((((....}}}}.||||||,.,{,,..{{(({..((((((.({(,{{((((.(((((((((.......)))}...............,))))).(((((((((......(((({...(((((((..(({({..(((((..((((......))))..)))))..))})..})}(((|.{(((......))))..}))))))))))),}..))))))))).))},).}}))).))))))..})))).|||....|||,,.,{{{{,,,,|,,|,,,,,,,|||{||||||||||.{||,,.}||||||{{{{{{,.,,,,(({{{{{.,|||{{{{{.{((({{{((({....).)))).}}}}}}})))))}.,})))..}})}}}}))))),.}}}|))},.}})))}}))))}})))))}||}}|{|||.|,{,,.|}{||},,...))),}..,},,.},)))),,..,}})))|||((({{.{(({.{((,.(((((((((.((((({,({((,(((.(((((((((((({{(((({{..,||,,,,,...(((((....((((({...})))))...))))){||||{{(,{....,.((((((((((....({((((({((((((((,(((({,,{{{.||........(((((((((((({.(((((,...(((.((.(((((((....))}})))))).))).{{{{||||{|,...(((((((((..(((.........)))...))))))))).................,,.,,,............................,,...,,,,........,,{{{{........)))).)))))))))),}....}}}{(((.((({(((((((((.{(....)})).)))))))..)))})))}{||,,,,.,..))),,})))})))).)))))))))...((((((((......((((.....))))...)))))))).....,,,...........(((((.(((...))).))))))),.}))..))))).)))}}((((((,{{{..,,{{((((((((((...))),..,.((((((...,,.(((....)))...,,.))))))|.{((((.((((({...)))))).))))),.,)))))).})})}..))))))......,,,...,}}))},}))))})))))))))).,,..,.}|||||||{((((({|||||.,,........|}},,,,|,.})))))))..{(((.((((((.....))))))..{(((.((({.{{{{{{{{{((((((((((((,((({({((,,{,{{{{{{{..,,....))),((((((((({{(((({.((((((.(((.((((((({,(........)))))))))..)))((({(((((.((((........))))..)))))).)))...)))))).)).))))..((((........))))....(((((((......))))))))))))))))),,.,,.{((((((....{{..((((((.((((.......{((({{,{,...,}}.,...})))}}.,,..}))}.})))))..}}.....))))))}}}}}}},,,}}}..,}})))||||.,,...,|,,.,,|}}.,,}}}}}}}|,|,,,{(((.((({{((({{,,,,.,{....(((({...})))).||,|||,,|},..,,...)))))))),)))),,.))))}})))))),,,,.}}}})},})))}.)))).)))),)))))))))))))))))}.,..))))))..))),,}}..,.,,,))))}.))))))))){{{{{{...,.,))})))|..}}}}}}|{({{{{|....,.})))))),.,,}||,|||||}||||,...,})))})))))},}},..,||||||}}|||||)))|)))}}.,))))})}}}}}}|))}}}},,,.,)))))}}||{|{|||,}}}}....(((((({((((((,{({{(,{{....{{{{|,,||{{||}|||||{..,.,|||||,({{{||..,},,,,{{|||}||.,}.))},,,)},))))})))))..,...,,,,..))))))))......,,,.})),,,))))})))}}..))))))|}||,.||||..,|,,.{{,...||||{||{{{{,,,..{{{{{|,..,||,|||||,.||||}}}},||{|{,,,,|,.(((....)))..........(((((.(((.((((((((.(.(((((((...........)))}}))).)..))))))))..))).)))))}}}|.(((((({,.((((...)))){(((((((.(((.(((((........))))).))))))))))}...,.)))))))(((((((.....))))))).,{.(((((((.((((((.((.......(((((........)))))..)).)))))).)))))))||,.,{{|||.,,,........||{{{....,,,))))),{{{||||,|{{|||,,.((((........)))),,,{{{({||{{|,||,.,.|||,....||..,},}}}||{((((,,,}}}},||.,......{{{{.}}))))},.}}}....||||,.{{(({((....................)))))}},|{,..,,||}||||}|,}}}............||||||},}}}..,}|||,|}|||.,{{(((((({,.{((,.{{,{{......,}}.))))}))))))).....})}})})|||}},))))}..,,.,}}})))}}},,,,..}|}}}|{{.{(({|.,,{||.....)))|.,},),..,{{|||{{{|,||{{{...,))|,||{||||}))}.,}}))))))},}}||}}},,}.,||,|}|,|||}..,,.,}}}}}}},},...........,}}}}}}}.|}}|||,.....||||||||...|||||||||,,,,,,..|,{(,((((((...(((((((.......(((({(((((((.(((.(((.(.(((.({.((.({({(((,(({(({(((((..((((...))))..)))}}}}|((....}}}.((((((((((((((.....(((.(((((((.((.,...........)).)))))))}}}.,((((((..((.(((({{(,,,,,...}}}...,,,,,)))).)).)))))),.....|{{(|||..}}})}||,,..,,,||}}..,{|,.,}}))}.,,...))))))))))))))......|,........{{{{{.,,......{{{{||....,},))))||||}.{{{{..,({(((..........}}}}),)))}...)))},,,},.,,.)))))))).,).)).))).)))).))).))))))))))).......))))},))..)))))).)),}}|}||,|}}|}}||||..,,,)))),.}),..)))},),.}))}}}|,.||.||}}}}},,,},...{((((((.....))))))),,,}..}},,))},,}}.,,,........|((((((,({{{{{{.,,,)))))}}...,))})},,},})),)}....

Transcripts

ID Sequence Length GC content
NM_000876.4 NCBI
GCCGCUGUCGCUGUCGCCGAGCCCAGUCGAGCCGCGCUCACCUCGGGCU… 14061 nt 0.4943
Summary

This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]

Forensic Context

A study in humans developed a targeted RNA sequencing protocol to predict the time-of-day of bloodstain deposition from 408 dried blood samples, where the IGF2R was included as a candidate mRNA marker for time-of-day prediction and its coefficient in the final penalised regression model was -0.105 for the sine component and 0.000 for the cosine component [Gosch et al. DOI:10.1016/J.Fsigen.2025.103287]. The final model achieved a root mean squared error of 3 hours and 44 minutes, with 78% of predictions correct within ±4 hours via five-fold cross-validation. A study in mice demonstrated that ionizing radiation (6.5 Gy) induced differential expression of numerous genes in bone marrow cells, where the IGF2R mRNA was down-regulated 0.12-fold 6 hours post-irradiation [Dai et al. DOI:10.1080/09553000600857389]. This finding was part of a broader microarray analysis identifying 34 up-regulated and 69 down-regulated genes involved in processes like DNA repair, apoptosis, and cell cycle control, with validation via RT-PCR and western blot confirming key results including reduced SIRT1 and increased P53 acetylation linked to apoptosis.