Basic Information

Symbol
IGFBP1
RNA class
mRNA
Alias
Insulin Like Growth Factor Binding Protein 1 PP12 IGF-Binding Protein 1 Placental Protein 12 IGF-BP25 HIGFBP-1 AFBP IBP1 Alpha-Pregnancy-Associated Endometrial Globulin Insulin-Like Growth Factor-Binding Protein 1 Growth Hormone Independent-Binding Protein Amniotic Fluid Binding Protein Binding Protein-28 Binding Protein-26 Binding Protein-25 IGFBP-1 IBP-1 Insulin-Like Growth Factor Binding Protein 1
Location (GRCh38)
7:45888360-45893660
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Chronological age estimation Postmortem interval inference Other applications
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_000596.4
Sequence length
1514.0 nt
GC content
0.4987

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-514.00 kcal/mol
Thermodynamic ensemble
Free energy: -545.29 kcal/mol
Frequency: 0.0000
Diversity: 329.45
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((....))).((((((((((.(((((((.((((((((((((((((....(.(((((((.(((..((((((.((((...((.....))....))))((((((.((.(((....((.(((((((.((((((((.(((.((((((((.(.((....))..).)))...))).))...))).)))))...))))))))))...))((.((((((((.....)))))))).))(((((((((..(((.(((((.(((((..((.(((....))).))..))))).)))))....((((.((.((........)).)).)))))))..))))))))).))).)).)))))).))).))).)))))))))).)..))).))))))))))).((((((((.((((((((.(((...))).)))...(((((.(((((.((.(((.....)))..)).))).)).)))))...)))))..))))))))((((((..(((((((..(((...((.(((((.((((((..((((((......))).).))..((((((...(.(((((...))))).)...))))))..((((((((...((((((((.(((....)))...)))))))).))))))))......(((((.(((...((((((((((.................)))))..))))).((((...((((.((((((......))))))..)))).....))))...))).)))))(((((.....)))))........))))))...))))).))...((((((....(((((........)))))...)))))))))..).)))))))))))).)).))))).)).....)))).))))))....((((.((((....)))).)))).((((...)))).........((((((((.(((((.....(((((...((((...........))))))).))...))))).))))))))(((((....)))))......((((((...(((((((((((((......))))))))))))).(((..(((((((((...((.........)).)))))))))..))).((((((.....))))))..(((((((((((((((((......(((((...((((((....((((((...((((.(((........((((((((((((.((((.((((((.....((...((((((((((((((..(((((..........)))))..))))))).))))......))).))....)))))).)))).....)))).))).))))).....))).))))...))))))))))))..)))))...((.((........)).))))).))))))))))))))....(((.((((((....)))))).)))....(((((......))))).(((..((((((.((.(((((((((........)))))))))...))...)))))))))..........))))))))..
Thermodynamic Ensemble Prediction
..,(((....))).((((((((((.({(((((.((((((((((((((((....,.(((((((.(((..((((((.((((...{{.....}}....)))){(((((.{{.{||,{,.({.((((((({((((((((.(((.((((({({.(.,(,,..,,..},)),.,.))).))...))).)))))...))))))))))...)){{.((((((((.....)))))))).)}(((((((((..(((.(((((.(((((..((.(((....))).))..))))).))))),,,.((((.,,{(({{......})}))})))))))..))))))))),|||.}}.)))))}.))).))).)))))))))).)..))).))))))))))).((((((((.((((({((.({(...}}}.|||,{.({((,.((({(.(({(,,....}))).,,))),).})})))))}..)))))..))))))))((((((..(((((({.,(((.,.((.(((((.((((((,.((((((......))).).))..((((((..,{.(((((...))))),|...})))))..((((((((.,,(((({{(({(((,...}}},}})))))))}.))))))))......{{{((,({{...((((((((((.................))))}.,))))).{(((...{{((.((((((......))))))..)))}.....)))}..,)}).)))))(((({.....)))))........))))))...))))).)).,.((((((....(((((........)))))...))))))))).,).)))))))))))).)).))))).}}....,}))),,)))))...{(,(({(({({{{{||,,.)))).||||}..))||,..((,{(((.((((((,,.((((,...,(({....|||.{{,,...((((((((....(((({{((({,,....,..}},)),)))}),}..))))))))......,{(((((((((((,.....)))))))))))}|,(((..(((((((((.,,,,.........,),)))))))))..))).||{{{|,,,,,)}}))}||(((((((((((((((((......{{{{{...((({{(,,,,((((((...((((.,,({......,(((({(((((((.((((.((((((,{,{,{,.||||,(((((((((((..(((((..........)))))..))))))).)))).....,}}}.......)))))).)))).....))))}))}.))})),,,},.}}.))))...)))))))))))).,|||||......,,..,.....,))))))).)))))))))))))).,..(((.{(((((....)))))}.)))....(((((,....,)))))..||....,|}}}}}.(((((((({,({...})))))))))).{{((....))))}}}}.,))))))))))))}))...

Transcripts

ID Sequence Length GC content
NM_000596.4 NCBI
AUCGGCCACCGCCAUCCCAUCCAGCGAGCAUCUGCCGCCGCGCCGCCGC… 1514 nt 0.4987
Summary

This gene is a member of the insulin-like growth factor binding protein (IGFBP) family and encodes a protein with an IGFBP N-terminal domain and a thyroglobulin type-I domain. The encoded protein, mainly expressed in the liver, circulates in the plasma and binds both insulin-like growth factors (IGFs) I and II, prolonging their half-lives and altering their interaction with cell surface receptors. This protein is important in cell migration and metabolism. Low levels of this protein may be associated with impaired glucose tolerance, vascular disease and hypertension in human patients. [provided by RefSeq, Aug 2017]

Forensic Context

A study in human and rat corpus cavernosum demonstrated that the IGFBP1 is a gene regulated by mechanical stress, as bulk RNA-seq of fibroblasts cultured on polyacrylamide gels of different stiffness showed its significant transcriptional alteration was associated with low mechanical force signaling [Yin et al. DOI:10.1016/j.celrep.2024.114760]. A review of multi-omics human biological age estimation identified the IGFBP1 as a proteomic aging biomarker with higher abundance in the age-dependent urine proteome of healthy men [Solovev et al. DOI:10.1016/j.mad.2019.111192]. A study in the blow fly *Calliphora vicina* demonstrated that the IGFBP1 shows a high variance in expression level under diapause conditions but not under non-diapause conditions, with its expression level not changing significantly with age, making a high variance in its expression across several larvae a supportive marker for diagnosing diapause to improve PMImin estimation accuracy during cold seasons [Fremdt et al. DOI:10.1007/s00414-013-0920-x].