| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAUGCGAGCACUGCGGCUGGGCGCUGAGGAUCAGCCGCUUCCUGCCUG… | 2613 nt | 0.5113 | |
| AGAUGCGAGCACUGCGGCUGGGCGCUGAGGAUCAGCCGCUUCCUGCCUG… | 2631 nt | 0.5135 |
This gene is a member of the insulin-like growth factor binding protein (IGFBP) family and encodes a protein with an IGFBP domain and a thyroglobulin type-I domain. The protein forms a ternary complex with insulin-like growth factor acid-labile subunit (IGFALS) and either insulin-like growth factor (IGF) I or II. In this form, it circulates in the plasma, prolonging the half-life of IGFs and altering their interaction with cell surface receptors. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the IGFBP3 was upregulated during long-term weight loss in subcutaneous adipose tissue of weight losers [Bollepalli et al. DOI:10.1038/ijo.2017.245]. In a separate human cell model, primary lung microvascular endothelial cells exposed to 10 Gy X-irradiation showed a greater than 15-fold downregulation of the IGFBP3 mRNA at 24 hours post-irradiation, as identified by RNA-seq and validated by RT-qPCR [Bouten et al. DOI:10.1038/s41598-021-03636-7]. A review of traumatic brain injury (TBI) in humans, rats, and mice established that serum levels of the IGFBP3 are depressed following acute TBI [Annunziato Mangiola et al. DOI:10.1155/2015/736104]. Furthermore, in human burn injury patients, the IGFBP3 is used in combination with IGF-1 to improve protein synthesis with fewer episodes of hypoglycemia [Williams et al. DOI:10.1016/j.cps.2017.02.013].