Basic Information

Symbol
IGFBP4
RNA class
mRNA
Alias
Insulin Like Growth Factor Binding Protein 4 IGFBP-4 IBP4 Insulin-Like Growth Factor-Binding Protein 4 IGF-Binding Protein 4 HT29-IGFBP BP-4 IBP-4 Insulin-Like Growth Factor Binding Protein 4
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_001552.3
Sequence length
2205.0 nt
GC content
0.6263

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-958.70 kcal/mol
Thermodynamic ensemble
Free energy: -993.59 kcal/mol
Frequency: 0.0000
Diversity: 492.20
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((.(((.((.(((((..(((((..((((....))))))))))))))..))((.(((((.(((((((((.(((((.((((.......)))).)))))....((((((((((((((....)))..((((...)))).((((.(((((.((((.(((((.(((.(((((.....((.(((((.((((.(.(((((.((((((.((((((.((..((..(((((((.((.((((.((...((((...))))((((.(((((((.(((((....(((((((((((..((......))..)))))))))))....))))).)).))))).))))..((((..(((((....((.......))...))))).)))))).))))..)).))))))).))..((((((((.((((.(((((....((((((((.(((((.....))))).)))))))))))))))))))))...))))..))...)))))).))))))........)))))..).))))))))).)))))))))).)))))))))...(((((.(((((((.((..(((....))).)).))))))).)).)))(((((((...(((((....((((....))))..((((((..........))))))................))))).((..((((((.((((.((....)))).))))))))..)).))))))).......))))).)).))...)))))))).))).....((((..((((((((.(((((......)))))...)))))))).)))).))))).))).).))))).))))).))).))))))))((..(((((...(.((((((.((....)).........((((((((.((.....(((.(.(((((.(((((.(((((((((((..(((.((......)).)))..))))....)))).))))))))...))))).))))..)).))))))))(((((((((((.((..((((....((((((.(((((..(.((.((.((((((.....((((((....).)))))..)))))).))...)).).))))).))))))....)))).)).)))))))))))(((((((.(((.((((.(........).)))).)))..).)))))).)))))).).))))).........(((((((((((((((....)))))))))))))))(((.(((((((((.((.((((((.(..((((((.((((((((...((.(...((((((((.(((........))).))))))))).)).)))))..))).))))))(((..((((...(((.(((..(((((.......)))))..))))))....))))..)))...).)))))))))))....)))))).)))..........(((((((((((.........((((....((((((((.......))))))))))))..))))))))))).(((.(((((...))))).))).....((.((((((((((....))).))))))).))..((((((((((((((((...((((((((....((((((((((((.(((((((((((((.((((((((..(((((..((((.(.......(((((...((((..........)))).)))))...).))))..))).)))))))))).))))))......(((((.(((......)))))))).......((((......)))).)))))))...))))))(((......))).....)))))))))).)))).(((...((.((.(((.(((.(((((((((((((.......((((((....)))))).((((((..((((((..((((.(((......(((.((.((((....((((((.(((.((((((((.((((.((....)).))))))))))))...))).)).))))....))))..)).))).((((((....))))))..(((.((((.((.....)))))))))..))))))).))).))).)))))).............))).))))))))))..)))))).)).)).)))((((.((((((..(((((....))).....))..))))))))))...))))))))))))))))((((.((((.....)))).)))).....))............
Thermodynamic Ensemble Prediction
(((((((((((,(({.((.(((((..(((((..((((....))))))))))))))..))((.(((((.(((((((((.(((((.((((.......)))).))))),,..((((((((((({((....}}}..((((...)))).(({(,(((((.((((.(((((.(((.(((((.....((.(((({{((((.(.(((((.((((((.({((((.{{.,{,..(((((((.((.((((.((...((((...))))((((.(((((((.(((((....(((((((((((..((......))..)))))))))))....))))).))}})))).))))..((((..(((((....,(.......,}...))))).)))))).))))..)).))))))).||..((((((((.((((.(((((....((((((((.(((((.....))))).)))))))))))))))))))))...))))..))...)))))).)))))).....,..)))))..).))))))))).)))))))))).))))))))).,.{(({(,(((((((.((..(((....))).)).))))))).)).))|(((((((...(((((....((((....))))..||||||.,........|,||||....,}}}........}}}}}.{(..(((((({(((,.{{....}}))}))})))))..)).))))))).......))))).)).))...)))))))).))).....((((..((((((((.(((((......)))))...)))))))).})}}.))))).))).).))))).))))).)))}})))))))((,.(({{({{{({,,(((({.{,,{,{|..,,,....((((((((.((.,,..,(({,.,,|||.{((,..,,(((((((({.{((,{(({{{.,.||{|,,..,)))}.,.))))})},)))))}.),))))}}})}..)).)))))))){|{{{{{((((,((,,(({(,,..((({(({(({((,{(.{{.,{,(((({{.,.|||||{{{..,,||},|||{{|,,,,)}))}}.||{{{}}}}}.))))}}....||||.}},))))}))}}||{{{{|||,{{{,(({{.|,|,,,.,,).))))})))}.).))))})})},)))})}),,)),,}}}....{{(((((((((((((....))))))))))))))}|||}|{{||||||}||.((((((.(,.((((((.((((((((...((.{,..((((((((.(({{,.....,))),))))))))}.)).)))))..))).))))))(((..((((...,{(.(((..(((((.......)))))..))),)}....))))..)))...,.}}}}}}))))),,..,,||||,|}}.,....,||.(((((((((((.........((((....((((((((.......))))))))))))..))))))))))).{({.(((((...))))).}}}...,.((.((((((((((....))).))))))).)).,{(((((((((((((((...((((((((....(((((((((((..(((((((((((((.((((((((..({(((..((((.,.,.....(((((...((((.......,..)))).)))))...,,))))..))).)})))))))).)))))}......(((((.(((......)))))))).....,,({{{......))))}))))}}|,{{|,,,}}|{{.}}},,}}))))).))))))))))}}}))..,,...((.((.(((.(((.(((((((((((((.......((((((....)))))).((((((..((((((..((((.(((......{,(,,,.{{((,,..((((((.(((.((((((((.{(((,((....)),))))))))))))...))).)).))))....}}}},.||{|||.((((,(,...,,))})}}}.))}||},{||,,..,,})).,.,..))))))).))).))).)))))).............))).))))))))))..))}))).)).)).,|{((({.((((((..(((((....))).....))..)))))))))))..)))))))))))))))}{(((.((({.....)))).))))......,....,,,)},..

Transcripts

ID Sequence Length GC content
AGCCGCUCAGCCCCCUGCCCCUCGCCGCCCGCCGCCUGCCUGGGCCGGG… 2205 nt 0.6263
Summary

This gene is a member of the insulin-like growth factor binding protein (IGFBP) family and encodes a protein with an IGFBP domain and a thyroglobulin type-I domain. The protein binds both insulin-like growth factors (IGFs) I and II and circulates in the plasma in both glycosylated and non-glycosylated forms. Binding of this protein prolongs the half-life of the IGFs and alters their interaction with cell surface receptors. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the IGFBP4 was upregulated during short-term weight loss in subcutaneous adipose tissue from obese participants [Bollepalli et al. DOI:10.1038/ijo.2017.245]. In a separate study in rats, the IGFBP4 was identified as a marker for an activated astrocyte subtype that inhibits IGF-I/II and may impair brain development during the acute phase of hypoxic-ischemic encephalopathy [Chen et al. DOI:10.1096/fj.202402891RR]. A review of experimental studies in rats and mice demonstrated that the IGFBP4 mRNA is upregulated close to the injury site in animal models of traumatic brain injury, where its increase is glutamate-dependent and it is potentially involved in edema formation [Mangiola et al. DOI:10.1155/2015/736104].