| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCGCGCCCUUGCCGCUGCCACCGCACCCCGCCAUGGAGCGGCCGUCG… | 1030 nt | 0.5981 | |
| ACUCGCGCCCUUGCCGCUGCCACCGCACCCCGCCAUGGAGCGGCCGUCG… | 1427 nt | 0.5214 |
This gene encodes a member of the insulin-like growth factor (IGF)-binding protein (IGFBP) family. IGFBPs bind IGFs with high affinity, and regulate IGF availability in body fluids and tissues and modulate IGF binding to its receptors. This protein binds IGF-I and IGF-II with relatively low affinity, and belongs to a subfamily of low-affinity IGFBPs. It also stimulates prostacyclin production and cell adhesion. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, and one variant has been associated with retinal arterial macroaneurysm (PMID:21835307). [provided by RefSeq, Dec 2011]
A study in human primary lung microvascular endothelial cells demonstrated that acute X-ray irradiation (10 Gy) induced a significant transcriptional response, with the IGFBP7 mRNA upregulated 1.7-fold at 24 hours post-irradiation as part of a broader senescence regulatory program identified via RNA-seq [Bouten et al. DOI:10.1038/s41598-021-03636-7]. This was accompanied by extensive gene expression changes leading to cell cycle arrest, DNA damage response, pro-inflammatory signaling, and endothelial-to-mesenchymal transition, with senescence confirmed in 80-85% of cells.