| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAGCCGAGCUGAGCGGAUCCUCACACGACUGUGAUCCGAUUCUUUCC… | 1758 nt | 0.6377 | |
| AGAAGCCGAGCUGAGCGGAUCCUCACACGACUGUGAUCCGAUUCUUUCC… | 1872 nt | 0.6330 |
This gene encodes a glycosylated, secreted protein containing a C-terminal fibrinogen domain. The encoded protein is induced by peroxisome proliferation activators and functions as a serum hormone that regulates glucose homeostasis, lipid metabolism, and insulin sensitivity. This protein can also act as an apoptosis survival factor for vascular endothelial cells and can prevent metastasis by inhibiting vascular growth and tumor cell invasion. The C-terminal domain may be proteolytically-cleaved from the full-length secreted protein. Decreased expression of this gene has been associated with type 2 diabetes. Alternative splicing results in multiple transcript variants. This gene was previously referred to as ANGPTL2 but has been renamed ANGPTL 4 . [provided by RefSeq, Sep 2013]
A study in humans demonstrated that serum levels and adipose tissue expression of the biomarker were significantly decreased in obese monozygotic twins compared to their non-obese co-twins, with intra-pair differences in serum levels inversely correlated with intra-pair differences in body mass index [Robciuc et al. DOI:10.1194/jlr.P015867].