| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACAUCAGGGGCUUGCUCUUGCAAAACCAAACCACAAGACAGACUUGC… | 1630 nt | 0.4534 | |
| AGUCCCUUCGGGGAGGCUUCUGGUGAAGGAGGAUCGCUAGAACCAAGCU… | 1476 nt | 0.4505 |
The protein encoded by this gene is a cytokine produced primarily by monocytes and to a lesser extent by lymphocytes. This cytokine has pleiotropic effects in immunoregulation and inflammation. It down-regulates the expression of Th1 cytokines, MHC class II Ags, and costimulatory molecules on macrophages. It also enhances B cell survival, proliferation, and antibody production. This cytokine can block NF-kappa B activity, and is involved in the regulation of the JAK-STAT signaling pathway. Knockout studies in mice suggested the function of this cytokine as an essential immunoregulator in the intestinal tract. Mutations in this gene are associated with an increased susceptibility to HIV-1 infection and rheumatoid arthritis. [provided by RefSeq, May 2020]
A study in rats demonstrated that the IL10 mRNA exhibited bimodal expression peaks at 4 and 20 hours following experimental fat embolization via triolein injection or femoral fracture, with expression significantly suppressed at 16 hours, suggesting its role in the inflammatory response to endothelial glycocalyx damage during fat embolism progression [Kuwata et al. DOI:10.1016/J.Legalmed.2024.102531]. In human patients, bioinformatics analysis identified the IL10 as a core immune-related differentially expressed gene significantly altered in both severe blunt trauma and burn cohorts, where it showed good diagnostic potential and a negative correlation with upregulated NKT cells in blunt trauma patients [Chen et al. DOI:10.3389/fgene.2022.1038222]. A study in human burn patients demonstrated that early expression of the IL10 gene in peripheral blood mononuclear cells, measured within 48 hours post-injury, was significantly increased compared to healthy controls and further increased with burn severity [Mahung et al. DOI:10.1097/TA.0000000000003602].