Basic Information

Symbol
IL10RA
RNA class
mRNA
Alias
Interleukin 10 Receptor Subunit Alpha HIL-10R CDW210A CD210a CD210 IL10R Interleukin-10 Receptor Subunit Alpha Interleukin-10 Receptor Subunit 1 Interleukin 10 Receptor, Alpha IL-10 Receptor Subunit Alpha IL-10R Subunit Alpha IL-10R Subunit 1 IL-10R1 Interleukin-10 Receptor Alpha Chain CD210 Antigen IL-10RA CDw210a
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_001558.4
Sequence length
3653.0 nt
GC content
0.5574

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1428.70 kcal/mol
Thermodynamic ensemble
Free energy: -1495.69 kcal/mol
Frequency: 0.0000
Diversity: 941.15
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((.((((.(((((..((((.(((.((((..((((((..(((((((....)))((((...((((((..(((....))).))))))))))))))..)))))).)))).)))))))..))..)))))))((((((....((((.((....))))))......))))))((((((((...(((..(((((((((...(((...((((((((..............((((...(((((....((((.(((.(((.((((((((((((((((......)))((((........))))......((((((..((((.................(((((((((((...((.((((((((.(((((....)))))((((((.((((((.....)))))).))))))((((((....(((((...((.((((......)))).))..))))).....))))))...((((((((...(((.(((..(((((((((((.((((((.((......)).))).((((......))))..((.((.((((.....((((......)))))))).)).)).))).)))))...)))))).(((...)))..)))..)))...)))))))).....................(((((((.((((....((((((((((((((((.((....(((..((((((....)))))).)))..............((((((((((.(((.....))).)))))).))))....((((((.........(((((....)))))........)))))))).)))))))..)))))))))............(((((((((((..(((((....)))))(((((....((((((....(((.(((((((((((((((....(((......(((((((((...((((...(((....)))......((.....))....))))))))))))))))))))))))))((((..(((.((........)))))....))))))))).)))....))))))))))).....(((((((...(((((..(((....(((((.(((.((((((((((.........(((((..(......)..)))))...)))))))..(((((((((((((..((((((..((....(((((((.....((.......)).....))).))))....)).))).)))..)))))))))))))((((((((.......))))))))))).)))....))))))))..)).))))))).)))....((((...))))..))))))))))).((((((......(((((((((....)))))))))...)))))).)))).)))))))((.((((........)))))))))))))).)))))))))))))((((((.((.(((((.((.((....)).(((((.((......)).)))))((((((.........((((.(((((((((((((((.........(((...(((((.((....)).))))).....))).........)))))).)))))))))...)))).)))))).......))))))))).))))))(((((((((((((((((.((..(((.(((((..((((........))))((((((..((....)).((((((.(((....(((((.(((((((..(((((.((....((((((...((((((...))))))..))).))).)).))))))))))))..))))))))))))))((((((((...((((.((((((.(((((......)))))))))))))))(((((..........))))).((((((((..((((((....(((((.((....))))))))))))))).))))))..(((((.(((((.((...(((((((........(((.(((((....))))).)))))))))).)).))))).)))))))))))))..))))))..(((((((...))))).)).....))))))))..))...)))))))))....)))))))).))))..)))))).(((..(((((((.......))))))).)))((((((..(((((((((((((......))).....(((((((((((((.(((((..((((......(((((((((((...(((((....((....(((.(((...(((((.((((..((...(((........)))...)))))))))))..))))))...)).....)))))...))))))))))).((((((((.....((((..((((((((((.(((((((.....(((((...)))))......((((((...((((((...)))))).(((((((((.(........).)))))))))...((((.....(((......)))....))))((((((...((((........))))(((((((...............)))))))....(((((((.((...)).)))))))........))))))...(((((.....))))).((((((((...))))....))))))))))..)))).))).)))))).))))....))))((((((((.(((........)))..)))..))))).....((((.((((.((((((.((((((((((((((...((((((.((...)))))))).))).).))))))))))..))))))..)))).))))...........((((((((((((((((((((((((.((.....)).)))))...((((.(((((((((((.(..((.(((((((((..........))))))..)))))..).))).))))))))....))))))))))(((((.(((.(((.((....)))))...))).))))))))))))))))))...(((((((((((((((((((.(((((((((((((((((.(((..(((....((((((......))))))...)))......))).)))))))))............)))))))).........(((....)))(((((((((((((.((.((((.((((((((...(((((((((((((......)))))))...))))))..))).......))))).)))).)))))))))).))))).(((((((...................)))))))))))))).....((((...)))).)))))))...))))).))))))))...(((((.(((...(((((....)))))((((......))))..((((....))))...)))..)))))))))..))))).)))))))))))..))..............((.((((.........)))).))(((....))))))).)))))).))))))))))))))))))).)))...)))))))....)))))))))..)))))))).)))....)))))))))......(((((.((((((((((...(((....((((.((((...(((......)))..)))))))))))..))))))))))..)))))...((((((....)))))).(((...(((((..(((((.....)))))...)))))...)))........)))..))))))))))).
Thermodynamic Ensemble Prediction
..{((.(((({(((((..((({{(((.((((..((((((..(((((((....))){{{(,{.((((((..(((....))).))))))})))})))..)))))).)))).)))))))..))..)))))))((((((....((((.((....))))))......))))))((((((((,,.{{{,..,(((((((...{{{...((((((((............,.((((...(((((....((((.(((.(((.((((((((((((((((({...,((((({..{{{{.(((({{{,,,,.((((((..((((,....,..,,..{,.{{(((((((((((...({.((((((((.(((((....)))))((((((.((((((.....)))))).))))))((((((....(((((...((.((((......)))).))..))))).....))))))...((((((((...(((.(((..(((((((((((,(((((((((......,......((((......))))...,....{(((.....((({......)))})))},)))))}),).)))))...)))))).(({...})).})))..))).,.))))))))........,,...........(((((((.((((....((((((((((((((((.({....({(..((((((....)))))).)))........,.....{(((((((((.(((.....))).)))))),))))....((((((.........(((((....)))))........)))))),).)))))))..)))))))))............(((((((((((..(((((.,(((({{.{(((,....,{((.,.,,{{{{,{,(((((((((((((.,..{{,......(((((((((,,.,({({{.((,...,),),,....{............,))))))))))))))}})))))))))}|||,..,,|,}}}}..,..,)))).,))))}))))))),},....||(((|||({.....)))))))|}{{(((((..(((....(((((.|||.{{{(((((((.,,,,....({{{{,.|.........)))))...)))))))..(((((((((((((..((((((..{{....(((((((.....((.......)).,...)))}}))).,..}).)))}}))..)))))))))))))((((((((.......))))))))}}}.....)).))))))))..)).)))}))}.{{({......})},......))))))))))).((((((......(((((((({....}))))))))...)))))).)))).)))))))(,{((((........)))))))))))))),)})))))))))))|}),||.||.,((((.(((((..((((((((((.,,......||{||,|(((((((........{(({{.(((((((((((((((........,({{,..(((((.((....)).)))))...,.))}.,.......))))))))))))))))...}))).)))))))}..{{{{{|||||,|{||||{((((({(({{({,,,,,|}||..,,.}|||,|}}||}},{(({{{{,|{((,((((..(({{{{,|.((((((.(((....(((((.((((((,.,(((((.((,,..((((({...((((((...))))))..})).))),,}.)))))))))))}..)))))))}))))))((((((((...,(((.((((((.(((((......))))))))))))))|(((((((({,{........,.((((((({..((((((....(((((.((....)))))))))))))}),}))))),)))))))))}(((((((.,.{{((.(((((...(((,(((((....))))).))),,..))))).},}))))))))))))))))).{||||||,.{{({({,..,|||,|,|||.,..|||}}}}}),)}.,)))))})))}},,.}||||||||,|||,,|||||{{,{({{(({{{(({{((((({{,,.,|{({{{{(({{,.....((((,........}}}}....,,.}},}))||((((((({,,,(((((((((((((((((,,..}}}}.(((((....)))))(((.(((...((({{{((((..((...(((........)))...)))))))))))..))))))((((((((,..((((((((((...))).)))))))}}}}}}}}((((..((((((((((.(((((((.....(((({...})))|,{,.,,((((((.{{((,,(({.(({{(((.{,(((((((.,........}.)))))))))))}{{{{....,(({....,,},}....))))((((((...((((........))))(((((((,,,.,,,{...,{.{||||||,....|||||||.,,,}})).,))))))}.......))))))..,(((((.....))))).))}.}}})))}))))}.}}})})))))))..)))).))).)))))).))))....)))).,,,}}}}}}},))))),,))))))),,))))))))}...((((.((((.((((((.((((((((((((((...((((({,((...)))))))).))).))))))))))))..))))))..)))).))))..,,{,.,{,.({,.,.,,((((({,(((.(((((.((.....)).)))))..}}}|)}|||||||||||}|},{,,{,,,|||||},.,,,.,..}}||}}..}))}}..),)})|))))}}}}.{{{||||,,,||,{({((.(((.(((.((....))))}.,,)}}.}}}})}|||||}||||||,.,))})))))})))))}.||,.((((((((({(((((({.(((..{(((,.,({,,,,,,.}}}}).|}},..}}}..}},.))).}))))))||{,....}},..)))))))))...,...|{(((....,)))))|,|{|||||||||}||||,((({{{((.,.(((((((((((((......)))))))...)))))).,)))})}}.,}))))}.)))).)))),,}))).,}))),|)))))))))}..))))}.)))),}}))))..))))))))}....}|},...))))}),,|((({{(({.{{{{.{{{..,{,,(,,{{,(({...||,...,,,|}}||,,}},))))..|||,.((((....)))).}})}}.,||||||},.,}))}}})))))))))|||,.,,..,{......,,.....}},,........})))))))),}}...,,),))).))....}))))..))))))))))))).)))...)))))))....))))))))),,)))))))).}})....)))))))||((((({(((((.{(((((((((..,(((,...{(((.((((...(((......)))..)))))))))))..))))))))))..))))}...((((((....)))))}{(,,{{.,..,,..}}}||,})))))))....,,,,|,,,|....,,,,..})),,))))))))))}.

Transcripts

ID Sequence Length GC content
AGUCCCAGCCCAAGGGUAGCUGGAGGCGCGCAGGCCGGCUCCGCUCCGG… 3653 nt 0.5574
Summary

The protein encoded by this gene is a receptor for interleukin 10. This protein is structurally related to interferon receptors. It has been shown to mediate the immunosuppressive signal of interleukin 10, and thus inhibits the synthesis of proinflammatory cytokines. This receptor is reported to promote survival of progenitor myeloid cells through the insulin receptor substrate-2/PI 3-kinase/AKT pathway. Activation of this receptor leads to tyrosine phosphorylation of JAK1 and TYK2 kinases. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Jan 2009]

Forensic Context

A study in rats demonstrated that methamphetamine administration induced significant transcriptional changes in isolated microglia/macrophages, where the IL10RA was significantly downregulated in the striatum at 2 hours post-treatment, indicating its involvement in the altered inflammatory signaling associated with the drug's effects [Kays et al. DOI:10.3390/brainsci9120340].