Basic Information

Symbol
IL12B
RNA class
mRNA
Alias
Interleukin 12B IL-12B CLMF2 NKSF2 CLMF NKSF Interleukin 12B (Natural Killer Cell Stimulatory Factor 2, Cytotoxic Lymphocyte Maturation Factor 2, P40) Natural Killer Cell Stimulatory Factor, 40 KD Subunit Cytotoxic Lymphocyte Maturation Factor 40 KDa Subunit NK Cell Stimulatory Factor Chain 2 Interleukin-12 Subunit Beta Interleukin-12 Beta Chain Interleukin 12, P40 IL12, Subunit P40 IL-12 Subunit P40 CLMF P40 Cytotoxic Lymphocyte Maturation Factor 2, P40 Natural Killer Cell Stimulatory Factor-2 IMD28 IMD29
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_002187.3
Sequence length
2364.0 nt
GC content
0.4370

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-685.77 kcal/mol
Thermodynamic ensemble
Free energy: -734.13 kcal/mol
Frequency: 0.0000
Diversity: 588.40
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((...(((((((.(((((((((....((((.....)))).)))).((.(((((.(((..((((.....))))))).))))).))((((((((((.....((......)).....)))))...))))).)))))..)))))))..(((((((((((((....(((((....)))))(((((......((((.(((......).))))))......((((((..((((.(((((((((.((((((((((((.((((...((((...(((((......)).)))((((((........))))))...(((((((....((((((((....(((((.(((((((...))))..))))))))...(((((.((...((((((.(((..((((((((..(((....)))..))))))))......)))..........))))))....)).)))))..((((((.........((((((.((((.((((((.(((.....(((((((((.((((((((...))))))))((((((....((.(.((..(((((...))))))).).))...))))))..(((((((....))))))).....((.((..((..(((((....)))))..))..)).)).(((((......))).))))).)))))).....))).)))...(((((...((.(((.((..(((..((.((....)).))..)))..))))).))....)))))(((((............)))))...........))).)))).))))))........)))))).))))))))..)))))))(((((((((((........)).))))))).))..))))..)))).)))...))))).)))))))))))))((....))...............))))..)))))).(((((((((((........))))...(((.(((....)))..))).(((((((.(((((((((...((((...))))((((((((((..(((((((((....))))).........))))...)))))))))).(((((((((......((((((((.(((((.(((((((((((((.((...((((.((((...............))))))))...)))))).)))))))))))))).((((...))))..((..((((((....)))))).))((((((((((((.((((...)))).)))..))))).))))..)))))))).))).)))))).)).))))))).))))))).........(((((((((..(((((((....)))))))....)))))))))...))))))))))))..(((((((....)))))))......(((.((((((....)))))))))...............(((((......))))).((((((..((.((((......)))).))..)))))).))))))))))))).((((..(((((((((((((((.((.......((((((((....)))))))))).))))))).(((...((..(((.((((((((((((((..((((.((((.(((((.(((((((((((.((...)).))))....((((....)))).)))))))..((((.((((.........)))).))))......))))).)))).)))).(((....))).(((((((.......((((((.((....((((.(.((((((((((.............................................)))))).)))).).))))..)).)))))).....)))))))....(((((((((..(((((((((....))))))))).(((((..((((.((.(((.......))).)).))))))))).................))))))))).........................(((((((((((((......((.((((((.......(((.(((...((((((....((.((.........))))....))))))))))))......((((....)))).......))))))..))......)))))))).).)))))))))))).....(((((.((((((((.((....))))))))))...(((((.........)))))(((.....)))(((((......))))))))))...(((..(((((.(((.......)))...)))))..))).((((....))))(((((....((((......))))..)))))..)))))))))..))...))).............))))))))....))))............))))))...........
Thermodynamic Ensemble Prediction
((((((....((((((({(({.((((....((((.....)))).)))).)))),})))))((((((....(((((((((((((((.((((((((((.....{{(((((((((.(((.(({(,.{{{|||,,{{,{,....,.,.}}},,,}},},,..{(((({,(((.{{{((.,,,,.}}))),....(({({,,,,}}}}.((((.(((.((.....))..))).)))),,|{|{{{,{{,(({{({{.,,{{||||}|}|}}))))}|,....,..,})))}))}}}})}..)))...))))))))}||{{{{,,,..|||||....(((({{(((((({...,)))..)))))))).,{{((((.,.....,)))).|||..((((((((..(((....)))..)))))))}.,,...,.........,,||||,|,....,),}}))||,,{,.....|||||{{((..((((....))))(((((......))))).,||.{(((((((...)))))))){{|||(,,,,((.{,|||.(((((...))))),).}.}}}}}))}}}}...{{{{{|,,.,||||,(((((.(((((.....((((((.,(({{{{||.,{((,((({((((.((.(((...))),)}((((((((.,(..(((.,.,...(((((.,....((((({...)))))).,.)))))....,...))).)..))))))))......((((({,,.,,.,,,..,||||{{...,,....(((({({{{{((,.,(,,,...|,.,,},}.}}}))))).}}))))})),)))).})))),,,)))}),))))))}),))))))...)))))))))).,}}})}))))))).)))))).)))).))))))).............(((((((((((((((.((((........))))...(((.(((....)))..))).(((((((.(((((((((...((((...))))((((((((((.,(((((((((....))))).........)))).,.)))))))))).((((((((({.....((((((((.{(({(.(((((((((((((.((.,.(((,,((((...............)))))))).,.))))))))))))))))}}}}|.{{{,...}}}|{{{{..((((((....)))))).)))}||{{{{,(((.((((...)))).)))..,}}}}.)).},,)))))))).,))))))))).)).))))))).)))))))..{{{{{{.,{{((((((..((((({{....})))})),,,,}}))))))}.,,{{(({....{(((.(((((((....))))))))))}..{{,(((((((....)))))))}}.......{{{{{,..{{(({......}})))})))},,}}}|.(((((({{{({,({.((({.,,...{{{,,,...})),..(((((....{{{.{((((((({...((,...((((((((....)))))))),}})}.,,.},,},,}}}))..))).....)))))...))))..)})))))))))).....((.((((.{{...}}.)))))).)))))))))))))))..|,(((.((((.((((.........)))).)))))))....((((,{((...(((((..(((((....)))))..)))))...))))))).........})))))))((((((..({{{{{,,((({,{||||,{,.................}}}.,})))},)),,,,}}.)),))))).))))))(((((((......)))}})))...(((((((((....))))))))).((((,.,((((.((.(((.......))).)).))))))))).))))))....((((((...))))))..................,||,...(((((((((((((((((,((..((,.,,,}..}},{((({,,...,,,....)))))..(((((.............)))))))))))(((((({((((....}}}}...((((((((,,.....,{{{{,{{{{..{{({......))))....}))),,,,.(((((((,,((....))))))))))...(((((.........))))).....))))))))..,...((((((((((..{{,{(((..{((((,(((.......)))..,})))}.,)}),|{{{....,}}|{({{(.,,,((({......)))).,))))),,},.,,.}))),))))))))}}.......)))))))...))))))))))).,.........))))))...........

Transcripts

ID Sequence Length GC content
AGAAGAAACAACAUCUGUUUCAGGGCCAUUGGACUCUCCGUCCUGCCCA… 2364 nt 0.4370
Summary

This gene encodes a subunit of interleukin 12, a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. Interleukin 12 is a disulfide-linked heterodimer composed of the 40 kD cytokine receptor like subunit encoded by this gene, and a 35 kD subunit encoded by IL12A. This cytokine is expressed by activated macrophages that serve as an essential inducer of Th1 cells development. This cytokine has been found to be important for sustaining a sufficient number of memory/effector Th1 cells to mediate long-term protection to an intracellular pathogen. Overexpression of this gene was observed in the central nervous system of patients with multiple sclerosis (MS), suggesting a role of this cytokine in the pathogenesis of the disease. The promoter polymorphism of this gene has been reported to be associated with the severity of atopic and non-atopic asthma in children. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human burn patients demonstrated that early peripheral blood mononuclear cell expression of IL-12, which was significantly decreased compared to healthy controls, serves as a biomarker for immune dysfunction and correlates with clinical outcomes including burn severity [Cressida Mahung et al. DOI:10.1097/TA.0000000000003602].