Basic Information

Symbol
IL13RA1
RNA class
mRNA
Alias
Interleukin 13 Receptor Subunit Alpha 1 CD213a1 Antigen IL-13Ra CD213a1 NR4 Interleukin-13 Receptor Subunit Alpha-1 Interleukin 13 Receptor, Alpha 1 IL-13 Receptor Subunit Alpha-1 IL13 Receptor Alpha-1 Chain Cancer/Testis Antigen 19 IL-13R Subunit Alpha-1 CT19 IL-13R-Alpha-1 IL-13RA1 IL13RA IL13R
Location (GRCh38)
Forensic tag(s)
Time since deposition estimation Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_001560.3
Sequence length
3996.0 nt
GC content
0.4269

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1149.00 kcal/mol
Thermodynamic ensemble
Free energy: -1229.27 kcal/mol
Frequency: 0.0000
Diversity: 1273.66
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((((..((((((.(((.....)))...)))))))))))).))((((((.((((((((((((((.((..((((((.((.((.......)).)).))))))..)).))))))))))............(((((.((.....(((.((.((....))..)))))))))))).....((((.......))))))))..)))))).((.((((.((....(((........))).)).))))))((((.((((((..(((.((((.........(((((...(((...((((((....((((((((((((((.((.(((((..(((....))).)))))))....((((((((.(((.((..(((((((......)))))))......((((((((((((((....((((((((((.(.(((.(((((((((.....(((((((...((((((..(((((((((..((((.......(((((((((((((................(((((.....((((((((..((((((((.............(((((((((((.......(((((((...((((((((((.((....)).).)))))))))(((((((.(((..((((.(((......))).))))...)))....((.((((.........))))..)))))))))......).))))))........(((((.............)))))..........((((((..(((((((......))).))))....)))))).....................(((..((((((....))))))..))).....(((.....))).........)))))))).))))))...)))))...)))).....)))).....)))))..(((((((((...(((((((((((.((....(((((((((.............))))))...)))....((((.....(((((((....(((((..((.((((((..(((....)))...((((((.....(((((((((((((...........................))).)).)))))))))))))))))))).))((((((((.......)))..)))))........((((((((((((............................((((.....((((((((......))))))))))))(((((.((((((((((((((((((((........(((((.(...(((......((((........))))....)))).)))))....((.(((......((.((((((.(((((.........))).)).)))))).)).))).))....)))))))..(((((((...................((((((((.................)))))))).....(((....((((((.(((...))).))))))....)))((((.((.................))))))..))))))).)))))))))).))).))))).........(((((....))))).......(((((.((.((((((.(.((...(((((.((((((...((((...))))..........(((((((((((((((.......((.(((((((((((((.........((((((...))))))......((((((((((.((((....))..)).)))))..)))))))))))))))))).)).(((((..(((.(((........))).)))))))).))))))....((((...))))..((((.((((((...)))))).))))..(((((((......(((.(.((((..((..(((((.(((((..((((...((..(((.((((((((...(((((((.(((...)))...))))))).....)))))....))).)))..))...))).)..)))))..)))))..))..)))).).)))......))))))).))))))))).(((((.((..(((..(((((((..(((..((((((((((((((.(((((((((.((((.((((((.(((((((..(((((((((((.....)))))))...................................(((((.....(((((..((((((((..((...((((....((((....((((...))))....))))....))))))..)))))))).....))))).....)))))..((......))....)))).....((((......)))))))))))))))))(((((.(((.((.....((.((.(((((((((((....))))).))))))..)).))...))))))))))((((((....)))))).....)))))))))((((((((((..((((...)).))..))))))))))......((((((((.(((.....)))))))))))..)))))))).............))))))))))..)))...)))))))..)))..))))))))))))).)))))...)).).)))))).)).)))))..........)))).))))))))((((((((((((((.(((.(((((((.((((((((((...)))....)))))))....((((((((((((((((((........)))))))))).....)).)))))).)))))....)).))).))))).)))))))))...)))))...))))))).....))))...)))))))))))))...))))))))).....)))))))))).)))(((((((...((((..(((.((((((((.............)))))))).))).))))...))))))).))))..))).)))..)))..)))))))))))))...)))))).)))))))))))..))))))...)))).)))))))))).........)).)))))))))))...(((((((((((((.((((......((((.....(((..((((((((((.((((....)))).))))..(((((((((((((((((.((((((..(((((((((...................(((((((...((((((((((.......))))).)))))...)))))))(((((.........)))))((.....))...(((((....))))))))))))))......((((..(((.......)))..))))......((((.(((.((((.((((((((.((((..(((((.((((((((((((....)))))))))))))))))..((((((.(((...(((.....)))...))).....(((((((((.((((((((.((((((...)))))).))....)))))).((((((((((((((((((...........((((((.......))))))..)))))))))))....)))))))........)))).)))))......))))))...............)))).))))))))))))))).))))..........(((......)))..((((.((....)))))).)))).))))))))))).))))))))((((.((((.((((((((((.........)))))))))).)))).))))...))))))...)))...(((((.((.(((....))))))))))...)))).....)))).)))).)))....))))))(((((((.....)))))))....(((((((.(((((......)))))..)))))))..(((((...((((.((((...............)))).))))....)))))..)))))))))))))).........((((((((.........)))))))).....((((((........(((((((((........)))))))))))))))......)))))).....)))....)))))........)))).))))))))).)))).
Thermodynamic Ensemble Prediction
...((((((((,.((((((.(((,....}}),|.}))))))))))).))||{((({.((((,(({((((((.(((((((((.((.,...,.},.))}))})))).)))))))))))).)))}.{{{{{((..(((((((,.,,,.{(((((((,,({((({{{{((,{{,{,({......||{{,,{(({,,,,.{{|||,|||,{{{(({((,{{{({.|.|,,.||.....|||,|....||||,((({(((,(({{(((.,,(({{{{{{...((((({{{(({...,{,,((.{{{((({{((({{,,{{.{(,(((({,.(((....))).)))))}},{{{((((((((,({{,{,..(((((((......)))))))...{{{((,,,,,,,|||||...,,((((,,,,,.|}||{,(((((,,(({....,|||,,({{{(,(((,{{(......(((((((((((..((((((((((((((..,.{,{,,.........,{{{{,.....(((......}})|{{{.....|||{,..{{({,,,.}}}}...}}}}||{{{({..,{(((((((({.((....)).,,))))))))|(((((((.{{,{{({{,..{,...,..|||{|,.....}}}.,,.||}||.||..||,,..,,,.....})))))),...,.},)}}},.......,.,,(((((((..(((.((((((((..........((((((..(((({{(......}}}.))))....)))))}.{{..,,{{,((({{((.,({,(({{((,(({...,|,||||{,|}|.....,{(,,...}|}.{{{,.....}}||}}}}}},}}.}}}})))...|}|)}..},|,,|}},}}),.,.,}.)))))))).....))}..))))))))),,.))))))))))))),{,{.{(((({......}}}},...,},|}||..,,.....,{{{{{.({{.(({..,,,,...}}}}}).)))}}}))))))))))}||||||,}}|||..||||,,...{{{{{{{{{{{.{.,..|,{||{|}|||,||.{({{(((||||,||((((((((.......}}}..}))))....{({....}}|,...,((,(({{{{{{{,.(((({{,,,.,|,,,,,,|..,,|{|{{....}}},,.,))))))....)}))))))))}.}}}},}))))}},))}},.}}},|||||}|..{(({..,...(({(........))))....)))).}}}}}..,,{{{..,...{,,((.((((((.(({((.,.....,,))}.)).)))))).)}.,,|,,{{,|.,}}||||||,|{{{{{...|.,...}}}}},..,.{(((((((.....,...........)))))))}....,}}}.((((,..,|}}|,.,}))}|}}},}},,}}},.((((.((,...............}))))))..}})}}})))))))))))))}))))))}})........{((((....))))).....,}}))}|},,.{{,,...,,||}}}||||,.||||||}}.}}}}}}}..{(((((...))))}|,{,,,(((((((....,,,({.|(((((((((((({{,...,,,((((({...})))))......{((({{((((.{{{{....)}..}).))))}..))))}))))))))))))},)).{{{({,.{((.(({...,,,..))),)}}))))).))))))}...,..,..})))))},|||}||||||...},}}})}))),}))|||||,}}}{{{({,.{.(((({,,..((((({....|))))).....|||}|({.({,(((((...(((((((.(({...}))...))))))).....)))))..}}})),}}}..,......,........,..(((((..{|..(((....)))..,,..))))).,.))))))},,.(((((.((.{(((..(((((((..(((..(((((((((((.((((.(((((((.{{{,{((((((.(((((((,{{{,,(((((((.....)))))))...................................{{{{{.....(((((..((((((((..,,.,{((((....((((....((({...))))....))))....))))))..)))))))).....)))))...,,))}||{{(,....,}))}...,,,,.....((((......)))))))))))))))))|{((({(({.({{,,,{{({{,.{((((((((((....))))).))))))....,.....,}},}}}}},{(((((....)))))).....}})))}}},((((((((((,.(((,...))},)..))))))))))......|||||||{.{{{,,,..}}|)))))})),,},}}})))}))}........}))))))))))..)))...)))))))..))),.))))))),)))),.,,|||,|{,,.,{|{{{((.((((({(((({.....((({.{{,,({...{{{,..|}}..))..},.)))}.|,,...,}}}..)))))....))))))))))))),.||||||{{((((((((((........)))))))))).....}}.}}}}}}.{((((.....))))}.,))))))))))))))))))))),.)))}}}}},........{{{{{{(({{{{{|({{{...,,)))},|.,{{{{(((,.,{((((,,(((((((...((((..(((.(((((({{.............)))))))).))).)))).,.))))))){|{{{{...{{{{........,.||{|,,||||,..,||||||{|,,|||||,,|{{{|||||{,..,,.,}},,,|||||{.{{{{{{{||{|,,,,,,,,,,........,,,,,,..}}|||.}}}}}||||}}}..((({{({((((({({.{(({....}))).}))),,,|({(({{((((((((((((((((..(((((((((...................(((((({,{{((({(((,,,...,,,,))))).}}},,...}}))))){((((.........))))|((.....)),..,((({....}}))})))))))))......{{{{..,{,,,....,))},{|||,.....,((((.(((.(((,{((((((((.((((.{(((((.((((((((((((....))))))))))))})))).,,((((({({{...(({....,|}}...}})||,.,||(((((((,((((((((.((((((...)))))).))....)))))}}}|,,,,,((((({{,{((....{{{{...((((((.......))))))..,)))),}}}}}...,))))||{{.{{{....,,.})),))}},))}))),}}....,,},,,,....)))).))))))))))))))).))))},......}}}},.......,|.,((((.{{...,}))))).)))).))))))))))).))))}},|((((.((((.((((((((((.........)))))))))).)))).))))}..)))))}...)))|,,{{{||.||.|||,,,,,}}}}}}))}...,)))}}.}}))).})}}.,}}))})))))((((((((((.....)))))))))).(((((((.,{{{{{,....}})))..)))))))..(((.....))),.},)))}..))))........,))}),,))))}}...,.,||||||||||||||..,,{....,{{|||{{.,,},,,..}))))))),,.}}}}|,}|}}}}}.||{((((((((.,....,.)))))))))}))))))))))},,}},))))})),..)}.}))))........,,,,.,,,,}}})}.,}}}.

Transcripts

ID Sequence Length GC content
CCAGCCCGGCCGGGCUCCGAGGCGAGAGGCUGCAUGGAGUGGCCGGCGC… 3996 nt 0.4269
Summary

The protein encoded by this gene is a subunit of the interleukin 13 receptor. This subunit forms a receptor complex with IL4 receptor alpha, a subunit shared by IL13 and IL4 receptors. This subunit serves as a primary IL13-binding subunit of the IL13 receptor, and may also be a component of IL4 receptors. This protein has been shown to bind tyrosine kinase TYK2, and thus may mediate the signaling processes that lead to the activation of JAK1, STAT3 and STAT6 induced by IL13 and IL4. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the IL13RA1 was included as a candidate mRNA marker for predicting the time-of-day of bloodstain deposition, with a coefficient of 0.847 for the sine component in the final penalized regression model [Gosch et al. DOI:10.1016/J.Fsigen.2025.103287]. In rhesus macaques, RNA-sequencing of left ventricular tissue identified the IL13RA1 as a shared upregulated differentially expressed gene in animals with hypertrophic cardiomyopathy compared to adult human HCM cases [Rivas et al. DOI:10.1038/s41598-024-82770-4].