| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUUCGCCAGGGGUUGGGACUCCGGGUGGCAGGCGCCCGGGGGAAUCC… | 2015 nt | 0.3861 | |
| CUUUUCGCCAGGGGUUGGGACUCCGGGUGGCAGGCGCCCGGGGGAAUCC… | 2336 nt | 0.4007 |
The protein encoded by this gene is a cytokine that regulates T and natural killer cell activation and proliferation. This cytokine and interleukine 2 share many biological activities. They are found to bind common hematopoietin receptor subunits, and may compete for the same receptor, and thus negatively regulate each other's activity. The number of CD8+ memory cells is shown to be controlled by a balance between this cytokine and IL2. This cytokine induces the activation of JAK kinases, as well as the phosphorylation and activation of transcription activators STAT3, STAT5, and STAT6. Studies of the mouse counterpart suggested that this cytokine may increase the expression of apoptosis inhibitor BCL2L1/BCL-x(L), possibly through the transcription activation activity of STAT6, and thus prevent apoptosis. Alternatively spliced transcript variants of this gene have been reported. [provided by RefSeq, Feb 2011]
A study in human post-mortem cardiac tissue demonstrated that immunohistochemical analysis using an anti-IL-15 antibody showed a positive reaction with expression in widespread foci in cases of acute myocardial infarction (AMI), while reactions were negative in cases of sudden cardiac death and traumatic death controls, identifying it as a potential immunohistochemical marker for AMI in forensic pathology [Pinchi et al. DOI:10.1111/jcmm.14463].