| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGUGCACCUGUGGGAUUGCCGCCAGGUGUGCAGGCCGCUCCAAGCCCA… | 1060 nt | 0.6330 |
The protein encoded by this gene is a T cell-derived cytokine that shares the sequence similarity with IL17. This cytokine was reported to stimulate the release of tumor necrosis factor alpha and interleukin 1 beta from a monocytic cell line. The expression of this cytokine was found to be restricted to activated T cells. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the IL17C was significantly upregulated at 60 days post-injury in microglia isolated from brains after controlled cortical impact, indicating its role in regulating immune responses during the chronic phase of traumatic brain injury [Izzy et al. DOI:10.3389/fncel.2019.00307]. A study in male albino rats (Rattus norvegicus) demonstrated that the IL17C transcript increased at 9 hours postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267].