| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAACACAGGCAUACACAGGAAGAUACAUUCACAGAAAGAGCUUCCUGCA… | 813 nt | 0.4748 |
The protein encoded by this gene is a cytokine that shares sequence similarity with IL17. This cytokine is expressed by activated T cells, and has been shown to stimulate the production of several other cytokines, including IL6, IL8, and CSF2/GM_CSF. This cytokine is also found to inhibit the angiogenesis of endothelial cells and induce endothelial cells to produce IL2, TGFB1/TGFB, and monocyte chemoattractant protein-1. [provided by RefSeq, Jul 2008]
A study in human postmortem brain tissue demonstrated that the IL17F mRNA was hypermethylated in the nucleus accumbens of subjects with alcohol use disorder compared to matched controls, with a mean methylation level of 0.556 in cases versus 0.250 in controls, and was identified among 26 hypermethylated mRNAs primarily involved in immune-related pathways such as IL-17 signaling [Liu et al. DOI:10.3390/genes13060958].